Schema for LRG Transcripts - Locus Reference Genomic (LRG) / RefSeqGene Fixed Transcript Annotations
  Database: hg38    Primary Table: lrgTranscriptAli Data last updated: 2021-09-23
Big Bed File: /gbdb/hg38/bbi/lrgBigPsl.bb
Item Count: 1,824
Format description: Locus Reference Genomic Transcript Annotations
fieldexampledescription
chromchr1Reference sequence chromosome or scaffold
chromStart167430639Start position in chromosome
chromEnd167518610End position in chromosome
nameLRG_36t1Name or ID of item, ideally both human readable and unique
score1000Score (0-1000)
strand-+ or - indicates whether the query aligns to the + or - strand on the reference
thickStart167431680Start of where display should be thick (start codon)
thickEnd167518465End of where display should be thick (stop codon)
reserved0RGB value (use R,G,B string in input file)
blockCount8Number of blocks
blockSizes1107,36,57,36,81,57,104,203,Comma separated list of block sizes
chromStarts0,2384,3380,4759,7930,8704,10024,87768,Start positions relative to chromStart
oChromStart0Start position in other chromosome
oChromEnd1681End position in other chromosome
oStrand++ or -, - means that psl was reversed into BED-compatible coordinates
oChromSize1681Size of other chromosome.
oChromStarts0,1107,1143,1200,1236,1317,1374,1478,Start positions relative to oChromStart or from oChromStart+oChromSize depending on strand
oSequencetgctttctcaaaggccccacagtcctccacttcctggggaggtagctgcagaataaaaccagcagagactccttttctcctaaccgtcccggccaccgctgcctcagcctctgcctcccagcctctttctgagggaaaggacaagatgaagtggaaggcgcttttcaccgcggccatcctgcaggcacagttgccgattacagaggcacagagctttggcctgctggatcccaaactctgctacctgctggatggaatcctcttcatctatggtgtcattctcactgccttgttcctgagagtgaagttcagcaggagcgcagacgcccccgcgtaccagcagggccagaaccagctctataacgagctcaatctaggacgaagagaggagtacgatgttttggacaagagacgtggccgggaccctgagatggggggaaagccgcagagaaggaagaaccctcaggaaggcctgtacaatgaactgcagaaagataagatggcggaggcctacagtgagattgggatgaaaggcgagcgccggaggggcaaggggcacgatggcctttaccagggtctcagtacagccaccaaggacacctacgacgcccttcacatgcaggccctgccccctcgctaacagccaggggatttcaccactcaaaggccagacctgcagacgcccagattatgagacacaggatgaagcatttacaacccggttcactcttctcagccactgaagtattcccctttatgtacaggatgctttggttatatttagctccaaaccttcacacacagactgttgtccctgcactctttaagggagtgtactcccagggcttacggccctggccttgggccctctggtttgccggtggtgcaggtagacctgtctcctggcggttcctcgttctccctgggaggcgggcgcactgcctctcacagctgagttgttgagtctgttttgtaaagtccccagagaaagcgcagatgctagcacatgccctaatgtctgtatcactctgtgtctgagtggcttcactcctgctgtaaatttggcttctgttgtcaccttcacctcctttcaaggtaactgtactgggccatgttgtgcctccctggtgagagggccgggcagaggggcagatggaaaggagcctaggccaggtgcaaccagggagctgcaggggcatgggaaggtgggcgggcaggggagggtcagccagggcctgcgagggcagcgggagcctccctgcctcaggcctctgtgccgcaccattgaactgtaccatgtgctacaggggccagaagatgaacagactgaccttgatgagctgtgcacaaagtggcataaaaaacatgtggttacacagtgtgaataaagtgctgcggagcaagaggaggccgttgattcacttcacgctttcagcgaatgacaaaatcatctttgtgaaggcctcgcaggaagacccaacacatgggacctataactgcccagcggacagtggcaggacaggaaaaacccgtcaatgtactaggatactgctgcgtcattacagggcacaggccatggatggaaaacgctctctgctctgctttttttctactgttttaatttatactggcatgctaaagccttcctattttgcataataaatgcttcagtgaaaatgcaSequence on other chrom (or edit list, or empty)
oCDS146..640CDS in NCBI format
chromSize248956422Size of target chromosome
match1681Number of bases matched.
misMatch0 Number of bases that don't match
repMatch0 Number of bases that match but are part of repeats
nCount0 Number of 'N' bases
seqType10=empty, 1=nucleotide, 2=amino_acid
ncbiTranscriptNM_198053.2NCBI transcript name
ensemblTranscriptEnsembl transcript name
ncbiProteinNP_932170.1NCBI protein name
ensemblProteinEnsembl protein name
_lrgParentLRG_36LRG ID without transcript decoration
geneNameCD247Corresponding gene name for this transcript
mouseOverNM_198053.2 NP_932170.1 CD247NCBI and Ensembl transcripts and proteins

Sample Rows
 
chromchromStartchromEndnamescorestrandthickStartthickEndreservedblockCountblockSizeschromStartsoChromStartoChromEndoStrandoChromSizeoChromStartsoSequenceoCDSchromSizematchmisMatchrepMatchnCountseqTypencbiTranscriptensemblTranscriptncbiProteinensemblProtein_lrgParentgeneNamemouseOver
chr1167430639167518610LRG_36t11000-167431680167518465081107,36,57,36,81,57,104,203,0,2384,3380,4759,7930,8704,10024,87768,01681+16810,1107,1143,1200,1236,1317,1374,1478,tgctttctcaaaggccccacagtcctccacttcctggggaggtagctgcagaataaaaccagcagagactccttttctcctaaccgtcccggccaccgctgcctcagcctctgcctcccagcctcttt ...146..64024895642216810001NM_198053.2NP_932170.1LRG_36CD247NM_198053.2 NP_932170.1   CD247
chr1169511953169586531LRG_553t11000-1695143121695863860252506,183,152,145,156,104,72,117,180,211,237,175,2821,213,151,215,100,178,166,222,144,213,123,92,303,0,3490,6458,8566,11243,11847,12883,13947,15961,17654,18832,24552,28340,32342,34488,37847,38686,40603,43228,44692,47199,48600,602 ...09179+91790,2506,2689,2841,2986,3142,3246,3318,3435,3615,3826,4063,4238,7059,7272,7423,7638,7738,7916,8082,8304,8448,8661,8784,8876,gcaagaactgcaggggaggaggacgctgccacccacagcctctagagctcattgcagctgggacagcccggagtgtggttagcagctcggcaagcgctgcccaggtcctggggtggtggcagccagcg ...146..682024895642291790001NM_000130.4ENST00000367797.9NP_000121.2ENSP00000356771.3LRG_553F5NM_000130.4 NP_000121.2 ENST00000367797.9 ENSP00000356771.3 F5
chr1172659044172666873LRG_58t11000+17265920117266601604505,46,57,1252,0,1050,5289,6577,01860+18600,505,551,608,gaggtgtttcccttagctatggaaactctataagagagatccagcttgcctcctcttgagcagtcagcaacagggtcccgtccttgacacctcagcctctacaggactgagaagaagtaaaaccgttt ...158..100324895642218600001NM_000639.1ENST00000367721.3NP_000630.1ENSP00000356694.2LRG_58FASLGNM_000639.1 NP_000630.1 ENST00000367721.3 ENSP00000356694.2 FASLG
chr1173824672173858546LRG_1270t11000+173825229173857705017684,100,67,102,96,124,47,107,70,180,108,63,153,219,111,76,1029,0,2014,3660,5987,6862,8703,9800,12267,13517,14694,16193,20556,25654,28676,29122,31993,32845,03336+33360,684,784,851,953,1049,1173,1220,1327,1397,1577,1685,1748,1901,2120,2231,2307,gaagggcgcttggaccccagcggcgatctgtgtttgggttcgcgctctgggagaattttggctttgctcgccttcctctttcagaagactcgaaatcggccagcaggtctgcgagatttgaaacgcga ...558..249524895642233360001NM_018122.5ENST00000649689.2NP_060592.2ENSP00000497569.1LRG_1270DARS2NM_018122.5 NP_060592.2 ENST00000649689.2 ENSP00000497569.1 DARS2
chr1173903803173917378LRG_577t11000-17390388817391725907262,65,391,138,216,367,160,0,3646,5748,6950,7995,10749,13415,01599+15990,262,327,718,856,1072,1439,tctgccccaccctgtcctctggaacctctgcgagatttagaggaaagaaccagttttcaggcggattgcctcagatcacactatctccacttgcccagccctgtggaagattagcggccatgtattcc ...120..151424895642215990001NM_000488.3ENST00000367698.4NP_000479.1ENSP00000356671.3LRG_577SERPINC1NM_000488.3 NP_000479.1 ENST00000367698.4 ENSP00000356671.3 SERPINC1
chr1179550538179575952LRG_887t11000-17955117217957586408913,79,56,204,83,73,104,362,0,2064,3937,6488,9140,10750,14151,25052,01874+18740,913,992,1048,1252,1335,1408,1512,cgcggacccgcagcgactccacagggactgcgctcccgtgcccctagcgctcccgcgctgctgctccagccgcccggcagctctgaggatggagaggagggcgcggagctcctccagggagtcccgcg ...89..124024895642218740001NM_014625.3ENST00000367615.9NP_055440.1ENSP00000356587.4LRG_887NPHS2NM_014625.3 NP_055440.1 ENST00000367615.9 ENSP00000356587.4 NPHS2
chr1183555561183590604LRG_88t11000-183556117183590329015669,178,112,152,26,76,69,142,44,60,108,135,109,83,449,0,4534,7633,7872,8443,10142,11358,11642,13580,15218,17623,18925,22037,31333,34594,02412+24120,669,847,959,1111,1137,1213,1282,1424,1468,1528,1636,1771,1880,1963,acactccacccctactcgccctctctctctctgcttctttccttttctctctcatggtagggttatgagtcagttgccaaaaggtggggacatttcctgatgcatttgcaacactgagaagttatctt ...276..185624895642224120001NM_000433.3ENST00000367535.8NP_000424.2ENSP00000356505.4LRG_88NCF2NM_000433.3 NP_000424.2 ENST00000367535.8 ENSP00000356505.4 NCF2
chr1186828948186988981LRG_596t11000+18685435418698850801887,102,82,149,114,38,142,137,223,115,138,93,72,243,185,196,158,605,0,25337,41486,64062,65149,78016,82299,103814,110059,111031,117688,117920,121708,127153,136460,148644,150366,159428,02879+28790,87,189,271,420,534,572,714,851,1074,1189,1327,1420,1492,1735,1920,2116,2274,actcaggataagactttctctaagtccggagctgaaaaaggatcctgactgaaagctagaggcattgaggagcctgaagattctcaggttttaaagacgctagagtgccaaagaagactttgaagtgt ...157..240624895642228790001NM_024420.3ENST00000367466.4NP_077734.2ENSP00000356436.3LRG_596PLA2G4ANM_024420.3 NP_077734.2 ENST00000367466.4 ENSP00000356436.3 PLA2G4A
chr1193121957193254815LRG_507t11000+193122200193250712017374,106,70,63,53,89,217,99,79,65,58,36,88,162,101,142,4140,0,3154,8216,13433,13579,16127,19892,25909,28346,30422,81837,90107,90432,111035,114298,127772,128718,05942+59420,374,480,550,613,666,755,972,1071,1150,1215,1273,1309,1397,1559,1660,1802,agtcaggcgttctccgcgggcagccggcggcggggccttgccttacagcgcggggtcctcggcggcctgggtggctactgcccctgctgctgtcgtaggcgaggacggctgttagtgctgctgctgtt ...244..183924895642259420001NM_024529.4ENST00000367435.5NP_078805.3ENSP00000356405.4LRG_507CDC73NM_024529.4 NP_078805.3 ENST00000367435.5 ENSP00000356405.4 CDC73
chr1196651877196747504LRG_47t11000+196652117196747313022298,186,106,77,192,171,174,195,177,183,177,177,183,180,177,183,186,174,177,177,183,394,0,21100,21979,24111,25598,27745,33186,37542,38185,61857,63715,73243,74592,74883,76468,84946,85597,88741,89997,91574,93939,95233,04127+41270,298,484,590,667,859,1030,1204,1399,1576,1759,1936,2113,2296,2476,2653,2836,3022,3196,3373,3550,3733,acagcattaacatttagtgggagtgcagtgagaattgggtttaacttctggcatttctgggcttgtggcttgtggttgattttttatttactttgcaaaagtttctgataggcggagcatctagtttc ...241..393624895642241270001NM_000186.3ENST00000367429.9NP_000177.2ENSP00000356399.4LRG_47CFHNM_000186.3 NP_000177.2 ENST00000367429.9 ENSP00000356399.4 CFH

LRG Transcripts (lrgTranscriptAli) Track Description
 

Description

This track shows the fixed (unchanging) transcript(s) associated with each Locus Reference Genomic (LRG) sequence. LRG sequences are manually curated, stable DNA sequences that surround a locus (typically a gene) and provide an unchanging coordinate system for reporting sequence variants. They are not necessarily identical to the corresponding sequence in a particular reference genome assembly (such as Dec. 2013 (GRCh38/hg38)), but can be mapped to each version of a reference genome assembly in order to convert between the stable LRG variant coordinates and the various assembly coordinates.

We import the data from the LRG database at the EBI. The NCBI RefSeqGene database is almost identical to LRG, but it may contain a few more sequences. See the NCBI documentation.

The LRG Regions track, in the Mapping and Sequencing Tracks section, includes more information about the LRG including the HGNC gene symbol for the gene at that locus, source of the LRG sequence, and summary of differences between LRG sequence and the genome assembly.

Methods

LRG sequences are suggested by the community studying a locus (for example, Locus-Specific Database curators, research laboratories, mutation consortia). LRG curators then examine the submitted transcript as well as other known transcripts at the locus, in the context of alignment and public expression data. For more information on the selection and annotation process, see the LRG FAQ, (Dalgleish, et al.) and (MacArthur, et al.).

Credits

This track was produced at UCSC using LRG XML files. Thanks to LRG collaborators for making these data available.

References

Dalgleish R, Flicek P, Cunningham F, Astashyn A, Tully RE, Proctor G, Chen Y, McLaren WM, Larsson P, Vaughan BW et al. Locus Reference Genomic sequences: an improved basis for describing human DNA variants. Genome Med. 2010 Apr 15;2(4):24. PMID: 20398331; PMC: PMC2873802

MacArthur JA, Morales J, Tully RE, Astashyn A, Gil L, Bruford EA, Larsson P, Flicek P, Dalgleish R, Maglott DR et al. Locus Reference Genomic: reference sequences for the reporting of clinically relevant sequence variants. Nucleic Acids Res. 2014 Jan;42(Database issue):D873-8. PMID: 24285302; PMC: PMC3965024