Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 713 in window, 31657975 - 31657983, 9 bps 
B D                   Human  ttctt-ggct
B D                   Chimp  ttctt-ggct
B D                 Gorilla  ttctt-ggct
B D               Orangutan  ttctt-ggct
B D                  Gibbon  ttctt-ggct
B D                  Rhesus  ttctt-ggct
B D     Crab-eating macaque  ttctt-ggct
B D                  Baboon  ttctt-ggct
B D            Green monkey  ttctt-ggtt
B D                Marmoset  ttctt-ggct
B D         Squirrel monkey  ttctt-ggct
B D                Squirrel  ttct--ggtt
     Lesser Egyptian jerboa  ctctt-ggct
               Prairie vole  ttctt-ggct
B D         Chinese hamster  ttctt-ggct
B D                   Mouse  ttttggggtt
B D                     Rat  tttttgggct
B D          Naked mole-rat  ttctc-agct
           Brush-tailed rat  ttctc-agct
B D                  Rabbit  ------ggct
B D                     Pig  ttctt-ggct
B D                  Alpaca  ttctt-ggct
             Bactrian camel  ttctt-ggct
B D                 Dolphin  ttctt-ggca
               Killer whale  ttctt-ggca
           Tibetan antelope  ttctc-agtt
B D                     Cow  ttctc-agct
B D                   Sheep  ttctc-agtt
              Domestic goat  ttctc-agtt
B D                   Horse  ttctc-agtt
B D        White rhinoceros  ttctt-ggct
B D                     Cat  ctcct-ggct
B D                     Dog  ctctt-ggct
B D                 Ferret   ctctt-ggct
B D                   Panda  ctctt-ggct
             Pacific walrus  ctctt-ggct
               Weddell seal  ctctt-ggct
           Black flying-fox  tttct-ggct
B D                 Megabat  tttct-ggct
B D                   Shrew  -tctt-ggtt
B D                Elephant  ttctt-ggct
B D                 Manatee  ttctc-ggct
B D               Armadillo  atctt-ggat
            Golden hamster  ==========
B D                    Pika  ==========
           Star-nosed mole  ==========
B D                  Tenrec  ==========
       Cape elephant shrew  ==========
                Chinchilla  ==========
B D              Guinea pig  ==========
                  Aardvark  ==========
          Cape golden mole  ==========
  D             Rock pigeon  ==========
B D         Tasmanian devil  ==========
B D                 Opossum  ==========
      David's myotis (bat)  ==========
        Chinese tree shrew  ==========
B D                Bushbaby  ==========

Inserts between block 1 and 2 in window
B D               Marmoset 283bp
B D        Squirrel monkey 297bp

Alignment block 2 of 713 in window, 31657984 - 31658001, 18 bps 
B D                   Human  tcaacacattcttttctc
B D                   Chimp  tcaacacattcttttctc
B D                 Gorilla  tcaacacattcttttctc
B D               Orangutan  gca--acagtcttttctc
B D                  Gibbon  tcaacacattcttttctc
B D                  Rhesus  tcgacacattcttttctc
B D     Crab-eating macaque  tcgacacattcttttctc
B D                  Baboon  tcaacacattcttttctc
B D            Green monkey  tcgacacattcttttctc
B D                Marmoset  tcaacacattcttttctc
B D         Squirrel monkey  tcaacacattcttttgtc
B D                Squirrel  ----------------tc
     Lesser Egyptian jerboa  ----------------tc
               Prairie vole  ----------------tc
B D         Chinese hamster  ----------------tc
B D                   Mouse  ----------------tc
B D                     Rat  ----------------tc
B D          Naked mole-rat  ----------------gt
           Brush-tailed rat  ----------------gt
B D                     Pig  -ccacact------cctc
B D                  Alpaca  -ccacactctt--tcccc
             Bactrian camel  -ccacactctt--tcccc
B D                 Dolphin  -aaacacc-------ccc
               Killer whale  -aaacacc-------ccc
           Tibetan antelope  -ccacacc--t--ctccc
B D                     Cow  -ccacacc--t--ctccc
B D                   Sheep  -ccacacc--t--ctccc
              Domestic goat  -ccacacc--t--ctccc
B D                   Horse  -ccacagactctttctcc
B D        White rhinoceros  -ccacagactcttccctc
B D                     Cat  -ccacagactctttcccc
B D                     Dog  -ctacagattc--tcccc
B D                 Ferret   -ccacagactc--tcccc
B D                   Panda  -ccacaggctc--tgccc
             Pacific walrus  -ccacagactc--tccct
               Weddell seal  -ccacagactc--tccct
           Black flying-fox  -ccacagattcttccgcc
B D                 Megabat  -ccacagattcttccgcc
B D                   Shrew  -ccaggctcca---ccct
B D                Elephant  -ctacagactctttcacc
B D                 Manatee  -ccacagactc--tcgtc
B D               Armadillo  -gcacagactctttttcc
            Golden hamster  ==================
B D                    Pika  ==================
           Star-nosed mole  ==================
B D                  Rabbit  ------------------
B D                  Tenrec  ==================
       Cape elephant shrew  ==================
                Chinchilla  ==================
B D              Guinea pig  ==================
                  Aardvark  ==================
          Cape golden mole  ==================
  D             Rock pigeon  ==================
B D         Tasmanian devil  ==================
B D                 Opossum  ==================
      David's myotis (bat)  ==================
        Chinese tree shrew  ==================
B D                Bushbaby  ==================

Inserts between block 2 and 3 in window
B D               Squirrel 7bp
    Lesser Egyptian jerboa 1bp
              Prairie vole 1bp
B D        Chinese hamster 1bp
B D                  Mouse 1bp
B D                    Rat 1bp
B D         Naked mole-rat 7bp
          Brush-tailed rat 7bp

Alignment block 3 of 713 in window, 31658002 - 31658042, 41 bps 
B D                   Human  catggga----gatgatgccagaagagggacagaacag----gg---c-cc----ag-
B D                   Chimp  catggga----gatgatgccagaagagggacagaacag----gg---c-cc----ag-
B D                 Gorilla  catggga----gatgatgccagaagagggacagaacag----gg---c-cc----ag-
B D               Orangutan  catggga----gatgatgccagaagagggacacaacag----gg---c-cc----ag-
B D                  Gibbon  catggga----gatgatgccagaagagggacagaacag----gg---c-cc----gg-
B D                  Rhesus  catggga----gatgatgccagaagagggacagaatag----gg---c-cc----tg-
B D     Crab-eating macaque  catggga----gatgatgccagaagagggacagaatag----gg---c-cc----tg-
B D                  Baboon  catggga----gatgatgccagaagagggacagaatag----gg---c-cc----tg-
B D            Green monkey  catggga----gacgatgccagaagagggacagaatag----gg---c-cc----tg-
B D                Marmoset  catggga----gttgatgctggaagagggacagaacag----gg---c-cc----tt-
B D         Squirrel monkey  catggga----gatgatgccggaagagggacagaacag----gg---c-cc----tt-
B D                Squirrel  catagaa----gatgttgcctgaagattg---acagaacagggt---c-tt----t--
     Lesser Egyptian jerboa  cagggaa----gatgttgcctgaggagag---gtgaca----at---g-cc----c--
               Prairie vole  cctgaga----gatgctgcctgaggaaaa---gtgcag----tt---ctct----c--
B D         Chinese hamster  catggga----gatgctgcctgaggaaag-----acaa----gt---c-ct----c--
B D                   Mouse  tatagca----gatgctg-cctgagaagg---gcacaa----gacttc-tt----c--
B D                     Rat  tggggca----gatgctgccctaggaagg---gtacaa----ga---c-tt----c--
B D          Naked mole-rat  cttgggagggggaggtcacctgaggaggg-cagaacag----gg---c-ct----c--
           Brush-tailed rat  cttggga----gatgtcacctgaggagggacagaacag----gg---c-cttgagc--
B D                  Rabbit  ------------gtgctgtgtcagaaagg---acggag----aa---g-ca----c--
B D                    Pika  catggaa----gatgttgtgggaggaggg---gcaaag----aa---g-tg----c--
B D                     Pig  catggga----aatatggtctgtggaagaacagaacag----ag---c-cc----t--
B D                  Alpaca  catggga----gaagtggactgaggagggacagaaaag----gg---c-cc----t--
             Bactrian camel  catggga----gaagtggactgaacagggacagaaaag----gg---c-cc----t--
B D                 Dolphin  cagggga----aatatggcctga-gaggaacagaacag----gg---t-cc----t--
               Killer whale  cagggga----aatatggcctga-gaggaacagaacag----gg---t-cc----t--
           Tibetan antelope  cagggga----aatacggcttaaggaggaacagaacag----gg---c-cc----t--
B D                     Cow  cagggga----aataccgcctaatgaggaacagaacag----gg---c-cc----t--
B D                   Sheep  cagggga----aatatggcctaaggaggaacagaacag----gg---c-cc----t--
              Domestic goat  cagggga----aatacggcctaaggaggaacagaacag----gg---c-cc----t--
B D                   Horse  catggga----gaagtggccagaggagggacagaacgg----gg---g-cc----t--
B D        White rhinoceros  cacggga----gaagtggccagaggagggacagaacgg----gg---t-cc----t--
B D                     Cat  ctcagga----gagctggcttgaggaggggcag-acag----gg---t-ct----t--
B D                     Dog  catag-------atctggctctgggagggacagaacag----gg---c-ct----t--
B D                 Ferret   cacagga----gatcgggcttagggtaggacagaacag----gg---c-ct----t--
B D                   Panda  cacag-------agctggcttggggagggacagaacag----gg---c-ct----t--
             Pacific walrus  cacagga----tatctggcttggggagggacagaacag----ag---c-ct----t--
               Weddell seal  cacagga----tatctggcttggggagggacagaacag----ag---c-ct----t--
           Black flying-fox  catggga----gatgtggcttgaggagggacagaacag----gg---c-cc----t--
B D                 Megabat  cgtggga----gatgtggtttgaggagggacagaacag----gg---c-cc----t--
B D                   Shrew  cacggca----gaagtgg-------------------------------cc----t--
B D                Elephant  cacgggg----gaggtgccctgaggagggccagagtaa----gg---t-ct----t-c
B D                 Manatee  cacgggg----ga-gtggcctgaggagggccagagtaa----gg---t-ct----t-g
B D               Armadillo  cacaagg----catgtgacctgaggacggccagagcag----ca---c-tc----t-t
            Golden hamster  ==========================================================
           Star-nosed mole  ==========================================================
B D                  Tenrec  ==========================================================
       Cape elephant shrew  ==========================================================
                Chinchilla  ==========================================================
B D              Guinea pig  ==========================================================
                  Aardvark  ==========================================================
          Cape golden mole  ==========================================================
  D             Rock pigeon  ==========================================================
B D         Tasmanian devil  ==========================================================
B D                 Opossum  ==========================================================
      David's myotis (bat)  ==========================================================
        Chinese tree shrew  ==========================================================
B D                Bushbaby  ==========================================================

Inserts between block 3 and 4 in window
B D                    Pig 1bp
B D                 Alpaca 1bp
            Bactrian camel 1bp
B D                Dolphin 1bp
              Killer whale 1bp
          Tibetan antelope 1bp
B D                    Cow 1bp
B D                  Sheep 1bp
             Domestic goat 1bp
B D                  Horse 1bp
B D       White rhinoceros 1bp
B D                    Cat 1bp
B D                    Dog 1bp
B D                Ferret  1bp
B D                  Panda 1bp
            Pacific walrus 2bp
              Weddell seal 1bp
          Black flying-fox 1bp
B D                Megabat 1bp
B D                  Shrew 1bp

Alignment block 4 of 713 in window, 31658043 - 31658052, 10 bps 
B D                   Human  ta----------aa--gca--tgg
B D                   Chimp  ta----------aa--gca--tgg
B D                 Gorilla  ta----------aa--gca--tgg
B D               Orangutan  ta----------aa--gca--tgg
B D                  Gibbon  ta----------aa--gta--tgg
B D                  Rhesus  ta----------aa--gta--tgg
B D     Crab-eating macaque  ta----------aa--gta--tgg
B D                  Baboon  ta----------aa--gta--tgg
B D            Green monkey  ta----------aa--gta--tgg
B D                Marmoset  ta----------aa--gta--tgg
B D         Squirrel monkey  ta----------aa--gta--tgg
         Chinese tree shrew  ta----------aa--gta--ggg
B D                Squirrel  ta----------ga--gcg--ggg
     Lesser Egyptian jerboa  tt----------tagggtg--tgg
               Prairie vole  tc----------ca----------
B D         Chinese hamster  tc----------ca----------
B D                   Mouse  ta----------ta----------
B D                     Rat  ta----------ta----------
B D          Naked mole-rat  tg----------aa--gcc--tgg
           Brush-tailed rat  tg-----------a--gca--tgg
B D                  Rabbit  tatttgaagcgtgc----------
B D                    Pika  ca----------gg----------
B D                     Pig  ta----------aa--gag--t--
B D                  Alpaca  ta----------aa--gtg--t--
             Bactrian camel  ta----------aa--gtg--t--
B D                 Dolphin  ta----------aa--gtg--t--
               Killer whale  ta----------aa--gtg--t--
           Tibetan antelope  tg----------aa--gtg--t--
B D                     Cow  tg----------ca--gtg--t--
B D                   Sheep  tg----------aa--gtg--t--
              Domestic goat  tg----------aa--gtg--t--
B D                   Horse  ta----------ta--gtg--t--
B D        White rhinoceros  ta----------ta--gtg--tgg
B D                     Cat  ta----------aa--gta--tgg
B D                     Dog  ta----------aa--gtatgcgg
B D                 Ferret   ta----------aa--gta--cag
B D                   Panda  ta----------aa--gta--cgg
             Pacific walrus  ta----------aa--gta--cgg
               Weddell seal  ta----------aa--gta--cag
           Black flying-fox  ta----------aa--ttg--tgt
B D                 Megabat  ta----------aa--ttg--tgt
B D                   Shrew  ta----------ga--gtt--tga
B D                Elephant  ca----------aa--gtg--tgg
B D                 Manatee  ta----------aa--gtg--tgg
B D               Armadillo  ca----------aa--gcg--tgg
            Golden hamster  ========================
           Star-nosed mole  ========================
B D                  Tenrec  ========================
       Cape elephant shrew  ========================
                Chinchilla  ========================
B D              Guinea pig  ========================
                  Aardvark  ========================
          Cape golden mole  ========================
  D             Rock pigeon  ========================
B D         Tasmanian devil  ========================
B D                 Opossum  ========================
      David's myotis (bat)  ========================
B D                Bushbaby  ========================

Inserts between block 4 and 5 in window
B D               Squirrel 1bp
    Lesser Egyptian jerboa 1bp
          Brush-tailed rat 518bp

Alignment block 5 of 713 in window, 31658053 - 31658055, 3 bps 
B D                   Human  ggc
B D                   Chimp  ggc
B D                 Gorilla  ggc
B D               Orangutan  ggc
B D                  Gibbon  ggc
B D                  Rhesus  ggc
B D     Crab-eating macaque  ggc
B D                  Baboon  ggc
B D            Green monkey  ggc
B D                Marmoset  gac
B D         Squirrel monkey  aac
         Chinese tree shrew  agc
B D          Naked mole-rat  --c
B D                  Rabbit  --t
B D                    Pika  --t
B D        White rhinoceros  ggc
B D                     Cat  ggc
B D                     Dog  -ac
B D                 Ferret   ggc
B D                   Panda  agc
             Pacific walrus  -gc
               Weddell seal  -gc
           Black flying-fox  gag
B D                 Megabat  gag
B D                   Shrew  ggc
B D                Elephant  ggc
B D                 Manatee  ggc
B D               Armadillo  ggc
            Golden hamster  ===
           Star-nosed mole  ===
B D                  Tenrec  ===
              Prairie vole  ---
B D         Chinese hamster  ---
B D                     Rat  ---
       Cape elephant shrew  ===
                Chinchilla  ===
B D                   Mouse  ---
          Brush-tailed rat  ===
    Lesser Egyptian jerboa  ===
B D              Guinea pig  ===
B D                 Dolphin  ---
B D                     Pig  ---
                  Aardvark  ===
          Cape golden mole  ===
  D             Rock pigeon  ===
B D         Tasmanian devil  ===
B D                 Opossum  ===
              Killer whale  ---
            Bactrian camel  ---
B D                   Sheep  ---
B D                     Cow  ---
          Tibetan antelope  ---
B D                Squirrel  ===
      David's myotis (bat)  ===
             Domestic goat  ---
B D                  Alpaca  ---
B D                   Horse  ---
B D                Bushbaby  ===

Inserts between block 5 and 6 in window
B D        Squirrel monkey 331bp
B D         Naked mole-rat 2bp
B D                 Rabbit 2bp
B D                   Pika 2bp

Alignment block 6 of 713 in window, 31658056 - 31658058, 3 bps 
B D                   Human  ctg
B D                   Chimp  ccg
B D                 Gorilla  ccg
B D               Orangutan  ccc
B D                  Gibbon  ccg
B D                  Rhesus  cca
B D     Crab-eating macaque  cca
B D                  Baboon  cca
B D            Green monkey  ccg
B D                Marmoset  tt-
         Chinese tree shrew  ctg
B D                Squirrel  tct
     Lesser Egyptian jerboa  gcc
               Prairie vole  cct
B D         Chinese hamster  cct
B D                   Mouse  gct
B D                     Rat  gcc
B D          Naked mole-rat  ccg
B D                  Rabbit  gca
B D                    Pika  gca
B D        White rhinoceros  cca
B D                     Cat  cca
B D                     Dog  cca
B D                 Ferret   cca
B D                   Panda  tca
             Pacific walrus  cca
               Weddell seal  cca
           Black flying-fox  aaa
B D                 Megabat  aaa
B D                   Shrew  cca
B D                Elephant  cca
B D                 Manatee  cca
B D               Armadillo  cca
            Golden hamster  ===
           Star-nosed mole  ===
B D                  Tenrec  ===
       Cape elephant shrew  ===
                Chinchilla  ===
          Brush-tailed rat  ===
B D              Guinea pig  ===
B D                 Dolphin  ---
B D                     Pig  ---
                  Aardvark  ===
          Cape golden mole  ===
  D             Rock pigeon  ===
B D         Tasmanian devil  ===
B D                 Opossum  ===
              Killer whale  ---
            Bactrian camel  ---
B D                   Sheep  ---
B D                     Cow  ---
          Tibetan antelope  ---
      David's myotis (bat)  ===
             Domestic goat  ---
B D                  Alpaca  ---
B D                   Horse  ---
B D                Bushbaby  ===
B D         Squirrel monkey  ===

Alignment block 7 of 713 in window, 31658059 - 31658063, 5 bps 
B D                   Human  gggcc
B D                   Chimp  gggcc
B D                 Gorilla  gggcc
B D               Orangutan  gggcc
B D                  Gibbon  gggcc
B D                  Rhesus  gggcc
B D     Crab-eating macaque  gggcc
B D                  Baboon  gggcc
B D            Green monkey  gggcc
         Chinese tree shrew  gagcc
B D                Squirrel  tgacc
     Lesser Egyptian jerboa  gtggc
               Prairie vole  ctgct
B D         Chinese hamster  ctgct
B D                   Mouse  ctgct
B D                     Rat  ctgct
B D          Naked mole-rat  aagcc
B D                  Rabbit  aggcc
B D                    Pika  gggca
B D        White rhinoceros  gggca
B D                     Cat  gggcc
B D                     Dog  gggcc
B D                 Ferret   gggcc
B D                   Panda  gggcc
             Pacific walrus  gggcc
               Weddell seal  gggcc
           Black flying-fox  gggag
B D                 Megabat  gggag
B D                Hedgehog  gagtc
B D                   Shrew  -ggtc
B D                Elephant  g----
B D                 Manatee  ggccc
B D               Armadillo  gggcc
            Golden hamster  =====
           Star-nosed mole  =====
B D                  Tenrec  =====
       Cape elephant shrew  =====
                Chinchilla  =====
          Brush-tailed rat  =====
B D              Guinea pig  =====
B D                 Dolphin  -----
B D                     Pig  -----
                  Aardvark  =====
          Cape golden mole  =====
  D             Rock pigeon  =====
B D         Tasmanian devil  =====
B D                 Opossum  =====
              Killer whale  -----
            Bactrian camel  -----
B D                   Sheep  -----
B D                     Cow  -----
          Tibetan antelope  -----
      David's myotis (bat)  =====
             Domestic goat  -----
B D                  Alpaca  -----
B D                   Horse  -----
B D                Bushbaby  =====
B D         Squirrel monkey  =====
B D                Marmoset  -----

Inserts between block 7 and 8 in window
B D         Naked mole-rat 115bp

Alignment block 8 of 713 in window, 31658064 - 31658064, 1 bps 
B D                   Human  a
B D                   Chimp  g
B D                 Gorilla  g
B D               Orangutan  a
B D                  Gibbon  g
B D                  Rhesus  t
B D     Crab-eating macaque  t
B D                  Baboon  t
B D            Green monkey  t
         Chinese tree shrew  a
B D                Squirrel  a
     Lesser Egyptian jerboa  a
               Prairie vole  g
B D         Chinese hamster  g
B D                   Mouse  g
B D                     Rat  g
B D                  Rabbit  a
B D                    Pika  g
B D        White rhinoceros  a
B D                     Cat  a
B D                     Dog  a
B D                 Ferret   a
B D                   Panda  a
             Pacific walrus  a
               Weddell seal  a
           Black flying-fox  a
B D                 Megabat  a
B D                Hedgehog  a
B D                   Shrew  a
B D                Elephant  a
B D                 Manatee  a
B D               Armadillo  g
            Golden hamster  =
           Star-nosed mole  =
B D                  Tenrec  =
B D          Naked mole-rat  =
       Cape elephant shrew  =
                Chinchilla  =
          Brush-tailed rat  =
B D              Guinea pig  =
B D                 Dolphin  -
B D                     Pig  -
                  Aardvark  =
          Cape golden mole  =
  D             Rock pigeon  =
B D         Tasmanian devil  =
B D                 Opossum  =
              Killer whale  -
            Bactrian camel  -
B D                   Sheep  -
B D                     Cow  -
          Tibetan antelope  -
      David's myotis (bat)  =
             Domestic goat  -
B D                  Alpaca  -
B D                   Horse  -
B D                Bushbaby  =
B D         Squirrel monkey  =
B D                Marmoset  -

Alignment block 9 of 713 in window, 31658065 - 31658094, 30 bps 
B D                   Human  gggacccccttgttcaggtgtga------cgac-----cat
B D                   Chimp  gggacccccttgttcaggtgtga------cgac-----cgt
B D                 Gorilla  gggacccccttgttcaggtgtga------tgac-----cgt
B D               Orangutan  gggacccccttgttcaggtgtga------ggac-----tgc
B D                  Gibbon  gggacccccttgttcaggtgtga------ggac-----cgt
B D                  Rhesus  ggcaccccc-tgttcaggtgtga------ggac-----cgt
B D     Crab-eating macaque  ggcaccccc-tgttcaggtgtga------ggac-----cgt
B D                  Baboon  ggcaccccc-tgttcaggtgtga------ggac-----tgt
B D            Green monkey  ggcaccccc-tgttcaggtgtga------ggac-----cgt
B D                Marmoset  -------ccttgttcaggtgtaa------ggat-----cgt
B D         Squirrel monkey  ggaactcccttgctcaggtgtaa------ggat-----cgt
         Chinese tree shrew  ggaacccccttggccaag-gtga------gggc-----agt
B D                Squirrel  gggacccccttgcccaggtttga------gagt-----g--
     Lesser Egyptian jerboa  gggacccacttgtgcaggtgtga------ggat-----g--
               Prairie vole  gggacccctctgtgcaggtcctg------ggga-----ggg
B D         Chinese hamster  ggaacccctttgggc-tgtcctg------ggga-----agg
B D                   Mouse  gggatcccattgtgcaggccctg------ggaa-----ggc
B D                     Rat  gggaccccattgt-------cct------ggaa-----ggc
B D                  Rabbit  gggacctccttggccagggatga------gggc-----aga
B D                    Pika  cgagttcccctgcccaggggtga------gggc-----aga
B D                     Pig  gggacccccctgcccaggtgtga------gggc-----ggt
B D                  Alpaca  gggacccccatgtgcaggtgtga------gggc-----agt
             Bactrian camel  gggacccccatgcgcaggtgtga------gggc-----agt
B D                 Dolphin  gggacccccttgcccaggtgtga------gggt--------
               Killer whale  gggacccccttgcccaggtgtga------gggt--------
           Tibetan antelope  ggga-ctctgtgc------gtga------gggg-----agt
B D                     Cow  ggaa-ccccttgcctaggtgtga------gggt-----agt
B D                   Sheep  ggga-ctccgtgc------gtga------gggt-----agt
              Domestic goat  ggga-ctccgtgc------gtga------gggt-----agt
B D                   Horse  gggacccccttgcccaggtgtga------gggc-----ggt
B D        White rhinoceros  gggacccccttgcccaggagtga------gggc-----ggt
B D                     Cat  ggaactcccttgcccaggaggga------gggc-----agt
B D                     Dog  gggacccccttgcccaggtggga------tggc-----agt
B D                 Ferret   gggactcccttgcccaggtggta-----ggggc-----agc
B D                   Panda  gggactcccttgccca-gtggga------gggc-----agt
             Pacific walrus  gggactccattgtgcaggtggga------gggc-----agt
               Weddell seal  gggactccattgtgcaggtggga------gggc-----agt
           Black flying-fox  gggac-cccttgtccagatgtaa------gggc-----agt
B D                 Megabat  gggac-cccttgtccagatgtaa------gggc-----agt
B D                Hedgehog  gggactcccctgtccaggtgtga------ggttccagggat
B D                   Shrew  gggactaactggcccaggaatgaaccttggggtcctggcat
B D                Elephant  tggacccccttgtccgggtctaa------gggc-----ggt
B D                 Manatee  tggaccccctggtctgaatctaa------ggac-----ggt
B D               Armadillo  gcaaacgccttgcccaggtctaa------tggc-----tgt
            Golden hamster  =========================================
           Star-nosed mole  =========================================
B D                  Tenrec  =========================================
B D          Naked mole-rat  =========================================
       Cape elephant shrew  =========================================
                Chinchilla  =========================================
          Brush-tailed rat  =========================================
B D              Guinea pig  =========================================
                  Aardvark  =========================================
          Cape golden mole  =========================================
  D             Rock pigeon  =========================================
B D         Tasmanian devil  =========================================
B D                 Opossum  =========================================
      David's myotis (bat)  =========================================
B D                Bushbaby  =========================================

Inserts between block 9 and 10 in window
B D               Squirrel 31bp
    Lesser Egyptian jerboa 66bp
              Prairie vole 55bp
B D        Chinese hamster 57bp
B D                  Mouse 46bp
B D                    Rat 54bp
B D                 Rabbit 22bp
B D                   Pika 10bp

Alignment block 10 of 713 in window, 31658095 - 31658108, 14 bps 
B D                   Human  cctac------------ga-------------ag-------gc---------acc
B D                   Chimp  cctac------------ga-------------ag-------gc---------acc
B D                 Gorilla  cctac------------aa-------------ag-------gc---------acc
B D               Orangutan  cctag------------ga-------------ag-------gc---------acc
B D                  Gibbon  cctag------------ga-------------aa-------gc---------acc
B D                  Rhesus  cctag------------ga-------------ag-------gc---------acc
B D     Crab-eating macaque  cctag------------ga-------------ag-------gc---------acc
B D                  Baboon  cctag------------ga-------------ag-------gc---------acc
B D            Green monkey  cctag------------ga-------------ag-------gc---------acc
B D                Marmoset  cgtag------------ga-------------ag-------gc---------acc
B D         Squirrel monkey  cgtag------------ga-------------ag-------gc---------acc
         Chinese tree shrew  ccaag------------ga-------------ggaatctcaga---------acc
B D                Squirrel  ccaaa------------ca-------------ag-------gg---------gtt
     Lesser Egyptian jerboa  ccaag------------ca-------------ag-------ca---------gct
               Prairie vole  ccaaa------------c---------------g-------ag---------acc
B D         Chinese hamster  ccaaa------------ca-------------ag-------ag---------acc
B D                   Mouse  ccaca------------ca-------------ag-------ag---------acc
B D                     Rat  ccaaa------------ca-------------ag-------at---------acc
                 Chinchilla  ccata------------ca-------------ag--------g---------act
B D                  Rabbit  gcagg------------ccgtaaagcctctt-gg-------gg---------acc
B D                    Pika  gcagg------------cagcaaaacctcttggg-------gg---------atc
B D                     Pig  actag------------ga-------------at-------ga---------acc
B D                  Alpaca  actag------------ga-------------at-------ga---------acc
             Bactrian camel  actag------------ga-------------at-------ga---------acc
           Tibetan antelope  tctaggaatgaacctcagg------------------------------------
B D                     Cow  tct----------------------------------------------------
B D                   Sheep  tctag------------ga-------------at-------ga---------acc
              Domestic goat  tctag------------ga-------------at-------ga---------acc
B D                   Horse  actag------------ga-------------at-------ga---------acc
B D        White rhinoceros  actag------------ga-------------at-------ga---------acc
B D                     Cat  gctgg------------ga-------------at-------ga---------acc
B D                     Dog  actgg------------ga-------------ag-------gaatttagaatacc
B D                 Ferret   actgg------------ca-------------at-------gattttagagtatc
B D                   Panda  actgg------------ga-------------at-------gaatttagagtacc
             Pacific walrus  actgg------------ga-------------at-------gaatttagagtacc
               Weddell seal  actgg------------ga-------------at-------gaatttagagtacc
           Black flying-fox  actag------------ga-------------at-------ga---------acc
B D                 Megabat  actag------------ga-------------at-------ga---------acc
B D                Hedgehog  gcaat---------gcagg-------------at-------g-------------
B D                   Shrew  cctgt------------ag-------------at-------gc---------atc
B D                Elephant  accag------------aa-------------at-------ga---------acc
B D                 Manatee  actag------------ga-------------at-------ga---------acc
B D               Armadillo  atcag------------ga-------------at-------ga---------acc
            Golden hamster  =======================================================
           Star-nosed mole  =======================================================
B D                  Tenrec  =======================================================
B D          Naked mole-rat  =======================================================
       Cape elephant shrew  =======================================================
          Brush-tailed rat  =======================================================
B D              Guinea pig  =======================================================
B D                 Dolphin  -------------------------------------------------------
                  Aardvark  =======================================================
          Cape golden mole  =======================================================
  D             Rock pigeon  =======================================================
B D         Tasmanian devil  =======================================================
B D                 Opossum  =======================================================
              Killer whale  -------------------------------------------------------
      David's myotis (bat)  =======================================================
B D                Bushbaby  =======================================================

Inserts between block 10 and 11 in window
B D               Elephant 52bp
B D                Manatee 52bp
B D              Armadillo 618bp

Alignment block 11 of 713 in window, 31658109 - 31658114, 6 bps 
B D                   Human  accc---------------------------------------------------ag
B D                   Chimp  accc---------------------------------------------------ag
B D                 Gorilla  accc---------------------------------------------------ag
B D               Orangutan  accc---------------------------------------------------ag
B D                  Gibbon  accc---------------------------------------------------ag
B D                  Rhesus  accc---------------------------------------------------ag
B D     Crab-eating macaque  accc---------------------------------------------------ag
B D                  Baboon  accc---------------------------------------------------ag
B D            Green monkey  accc---------------------------------------------------ag
B D                Marmoset  acgc---------------------------------------------------tg
B D         Squirrel monkey  actc---------------------------------------------------tg
         Chinese tree shrew  tctctacttttacagggacacaaaacccttccatgaactcaaatgagggtcttttag
B D                Squirrel  gcct---------------------------------------------------ag
     Lesser Egyptian jerboa  gccc---------------------------------------------------cg
               Prairie vole  actt---------------------------------------------------ca
B D         Chinese hamster  actg---------------------------------------------------ca
B D                   Mouse  acta---------------------------------------------------ca
B D                     Rat  actg---------------------------------------------------ca
                 Chinchilla  gtcc---------------------------------------------------ag
B D                  Rabbit  ctag---------------------------------------------------ca
B D                    Pika  ccgg---------------------------------------------------ca
B D                     Pig  --tc---------------------------------------------------gg
B D                  Alpaca  --tc---------------------------------------------------ac
             Bactrian camel  --tc---------------------------------------------------ac
B D                     Cow  --------------------------------------------------------a
B D                   Sheep  --tc---------------------------------------------------ag
              Domestic goat  --tc---------------------------------------------------ag
B D                   Horse  --tc---------------------------------------------------ag
B D        White rhinoceros  --tc---------------------------------------------------ag
B D                     Cat  --tc---------------------------------------------------tg
B D                     Dog  --tc---------------------------------------------------cg
B D                 Ferret   --tc---------------------------------------------------ca
B D                   Panda  ---t---------------------------------------------------ca
             Pacific walrus  -ctc---------------------------------------------------tg
               Weddell seal  -ctc---------------------------------------------------tg
           Black flying-fox  --tc---------------------------------------------------tg
B D                 Megabat  --tc---------------------------------------------------tg
B D                   Shrew  --ct---------------------------------------------------tc
B D                Elephant  gtcc---------------------------------------------------ag
B D                 Manatee  gtcc---------------------------------------------------ag
B D                Hedgehog  ---------------------------------------------------------
            Golden hamster  =========================================================
           Star-nosed mole  =========================================================
B D                  Tenrec  =========================================================
B D          Naked mole-rat  =========================================================
B D               Armadillo  =========================================================
       Cape elephant shrew  =========================================================
          Brush-tailed rat  =========================================================
B D              Guinea pig  =========================================================
B D                 Dolphin  ---------------------------------------------------------
                  Aardvark  =========================================================
          Cape golden mole  =========================================================
  D             Rock pigeon  =========================================================
B D         Tasmanian devil  =========================================================
B D                 Opossum  =========================================================
              Killer whale  ---------------------------------------------------------
          Tibetan antelope  ---------------------------------------------------------
      David's myotis (bat)  =========================================================
B D                Bushbaby  =========================================================

Alignment block 12 of 713 in window, 31658115 - 31658120, 6 bps 
B D                   Human  g------------catca
B D                   Chimp  g------------catca
B D                 Gorilla  g------------catca
B D               Orangutan  g------------catca
B D                  Gibbon  g------------catca
B D                  Rhesus  g------------catca
B D     Crab-eating macaque  g------------catca
B D                  Baboon  g------------catca
B D            Green monkey  g------------catca
B D                Marmoset  g------------catca
B D         Squirrel monkey  g------------catca
         Chinese tree shrew  g------------cttta
B D                Squirrel  g------------cttcc
     Lesser Egyptian jerboa  g------------ctttt
               Prairie vole  g------------cctca
B D         Chinese hamster  a------------cctca
B D                   Mouse  g------------ctcta
B D                     Rat  g------------ctcag
                 Chinchilla  g------------cttcc
B D                  Rabbit  ctgggcggcccagcttgg
B D                    Pika  c------------cttgg
B D                     Pig  t------------gctcc
B D                  Alpaca  g------------ggtcc
             Bactrian camel  g------------ggtcc
B D                 Dolphin  -------------ggtca
               Killer whale  -------------ggtca
           Tibetan antelope  -------------gatcc
B D                     Cow  g------------gaatg
B D                   Sheep  g------------ggccc
              Domestic goat  g------------ggccc
B D                   Horse  g------------ggtcc
B D        White rhinoceros  g------------ggtcc
B D                     Cat  g------------ggtcc
B D                     Dog  g------------ggttc
B D                 Ferret   g------------ggtcc
B D                   Panda  g------------ggtcc
             Pacific walrus  g------------ggtcc
               Weddell seal  g------------ggtcc
           Black flying-fox  g------------ggccc
B D                 Megabat  g------------ggccc
B D                Hedgehog  ---------------tcc
B D                   Shrew  t------------gctcc
B D                Elephant  g------------cttca
B D                 Manatee  g------------cttca
B D               Armadillo  g------------ctcca
            Golden hamster  ==================
           Star-nosed mole  ==================
B D                  Tenrec  ==================
B D          Naked mole-rat  ==================
       Cape elephant shrew  ==================
          Brush-tailed rat  ==================
B D              Guinea pig  ==================
                  Aardvark  ==================
          Cape golden mole  ==================
  D             Rock pigeon  ==================
B D         Tasmanian devil  ==================
B D                 Opossum  ==================
      David's myotis (bat)  ==================
B D                Bushbaby  ==================

Inserts between block 12 and 13 in window
    Lesser Egyptian jerboa 2bp
B D                Dolphin 22bp
              Killer whale 22bp
B D                    Cow 14bp

Alignment block 13 of 713 in window, 31658121 - 31658123, 3 bps 
B D                   Human  tta
B D                   Chimp  tta
B D                 Gorilla  tta
B D               Orangutan  tta
B D                  Gibbon  tta
B D                  Rhesus  tta
B D     Crab-eating macaque  tta
B D                  Baboon  tca
B D            Green monkey  tta
B D                Marmoset  tca
B D         Squirrel monkey  tta
         Chinese tree shrew  tct
B D                Squirrel  att
     Lesser Egyptian jerboa  tct
               Prairie vole  -ct
B D         Chinese hamster  cct
B D                   Mouse  ttt
B D                     Rat  ttt
                 Chinchilla  tcc
B D                  Rabbit  tct
B D                    Pika  t--
B D                     Pig  ttg
B D                  Alpaca  tct
             Bactrian camel  tct
B D                 Dolphin  tct
               Killer whale  tct
           Tibetan antelope  tcg
B D                     Cow  tcg
B D                   Sheep  tcg
              Domestic goat  tcg
B D                   Horse  cct
B D        White rhinoceros  cct
B D                     Cat  tct
B D                     Dog  tct
B D                 Ferret   ttg
B D                   Panda  tct
             Pacific walrus  tct
               Weddell seal  tct
           Black flying-fox  tct
B D                 Megabat  tct
B D                Hedgehog  tca
B D                   Shrew  cca
B D                Elephant  --t
B D                 Manatee  --g
                   Aardvark  --t
B D               Armadillo  tct
            Golden hamster  ===
           Star-nosed mole  ===
B D                  Tenrec  ===
B D          Naked mole-rat  ===
       Cape elephant shrew  ===
          Brush-tailed rat  ===
B D              Guinea pig  ===
          Cape golden mole  ===
  D             Rock pigeon  ===
B D         Tasmanian devil  ===
B D                 Opossum  ===
      David's myotis (bat)  ===
B D                Bushbaby  ===

Inserts between block 13 and 14 in window
B D                 Baboon 2bp
B D                    Pig 44bp
B D                 Alpaca 43bp
            Bactrian camel 44bp
B D                Dolphin 44bp
              Killer whale 44bp
          Tibetan antelope 43bp
B D                    Cow 43bp
B D                  Sheep 43bp
             Domestic goat 43bp
B D                  Horse 60bp
B D       White rhinoceros 59bp
B D                    Cat 62bp
B D                    Dog 61bp
B D                Ferret  59bp
B D                  Panda 61bp
            Pacific walrus 61bp
              Weddell seal 61bp
          Black flying-fox 62bp
B D                Megabat 62bp
B D               Hedgehog 25bp
B D                  Shrew 25bp

Alignment block 14 of 713 in window, 31658124 - 31658128, 5 bps 
B D                   Human  gaccg
B D                   Chimp  gaccg
B D                 Gorilla  gaccg
B D               Orangutan  gaccg
B D                  Gibbon  gactg
B D                  Rhesus  gacca
B D     Crab-eating macaque  gacca
B D                  Baboon  gaccg
B D            Green monkey  gaccg
B D                Marmoset  gacca
B D         Squirrel monkey  gacca
         Chinese tree shrew  gaata
B D                Squirrel  gaata
     Lesser Egyptian jerboa  gcgcg
               Prairie vole  gagtg
B D         Chinese hamster  gagct
B D                   Mouse  gagtg
B D                     Rat  gagcg
                 Chinchilla  gaaca
B D                  Rabbit  gaatg
B D                     Pig  acata
B D                  Alpaca  accta
             Bactrian camel  accta
B D                 Dolphin  acata
               Killer whale  acata
           Tibetan antelope  gccta
B D                     Cow  accta
B D                   Sheep  gccta
              Domestic goat  gccta
B D                   Horse  acata
B D        White rhinoceros  acata
B D                     Cat  gaata
B D                     Dog  tagta
B D                 Ferret   gagta
B D                   Panda  gaata
             Pacific walrus  gacta
               Weddell seal  gaata
           Black flying-fox  atata
B D                 Megabat  atata
B D                Hedgehog  gtgaa
B D                   Shrew  gcaag
            Star-nosed mole  gaaca
B D                Elephant  gagag
B D                 Manatee  gagaa
                   Aardvark  tagtg
B D               Armadillo  gaaca
            Golden hamster  =====
B D                    Pika  -----
B D                  Tenrec  =====
B D          Naked mole-rat  =====
       Cape elephant shrew  =====
          Brush-tailed rat  =====
B D              Guinea pig  =====
          Cape golden mole  =====
  D             Rock pigeon  =====
B D         Tasmanian devil  =====
B D                 Opossum  =====
      David's myotis (bat)  =====
B D                Bushbaby  =====

Inserts between block 14 and 15 in window
B D               Elephant 2bp
B D                Manatee 6bp
                  Aardvark 2bp

Alignment block 15 of 713 in window, 31658129 - 31658135, 7 bps 
B D                   Human  tctcaaa
B D                   Chimp  tctcaaa
B D                 Gorilla  tctcaaa
B D               Orangutan  tctcaaa
B D                  Gibbon  tctcaaa
B D                  Rhesus  tctcaaa
B D     Crab-eating macaque  tctcaaa
B D                  Baboon  tctcaaa
B D            Green monkey  tctcaaa
B D                Marmoset  tctcaaa
B D         Squirrel monkey  tctcaaa
         Chinese tree shrew  tctcaac
B D                Squirrel  tctcaaa
     Lesser Egyptian jerboa  tctcaag
               Prairie vole  tttcaaa
B D         Chinese hamster  tctcaag
B D                   Mouse  tttcaag
B D                     Rat  cttcaag
                 Chinchilla  gcccaag
B D                  Rabbit  tttcaac
B D                     Pig  ttgcaaa
B D                  Alpaca  tctcaaa
             Bactrian camel  tctcaaa
B D                 Dolphin  tctcaaa
               Killer whale  tctcaaa
           Tibetan antelope  tctcgaa
B D                     Cow  tctcaaa
B D                   Sheep  tctcgaa
              Domestic goat  tcttgaa
B D                   Horse  tctcaaa
B D        White rhinoceros  tctcaaa
B D                     Cat  gctcaag
B D                     Dog  tttcaaa
B D                 Ferret   tctc-aa
B D                   Panda  tctcaaa
             Pacific walrus  tctcaaa
               Weddell seal  tctcaaa
           Black flying-fox  tcttaag
B D                 Megabat  tcttaag
B D                Hedgehog  cctc---
B D                   Shrew  tctc-aa
            Star-nosed mole  tctc---
B D                Elephant  tctccac
B D                 Manatee  tctccaa
           Cape golden mole  tctccac
                   Aardvark  tttccag
B D               Armadillo  tctcaaa
            Golden hamster  =======
B D                    Pika  -------
B D                  Tenrec  =======
B D          Naked mole-rat  =======
       Cape elephant shrew  =======
          Brush-tailed rat  =======
B D              Guinea pig  =======
  D             Rock pigeon  =======
B D         Tasmanian devil  =======
B D                 Opossum  =======
      David's myotis (bat)  =======
B D                Bushbaby  =======

Inserts between block 15 and 16 in window
B D               Squirrel 2bp

Alignment block 16 of 713 in window, 31658136 - 31658142, 7 bps 
B D                   Human  agaag---ag
B D                   Chimp  agaag---ag
B D                 Gorilla  agaag---ag
B D               Orangutan  agaag---ag
B D                  Gibbon  agaag---ag
B D                  Rhesus  agaaa---ag
B D     Crab-eating macaque  agaaa---ag
B D                  Baboon  agaaa---ag
B D            Green monkey  agtaa---ag
B D                Marmoset  agaag---ag
B D         Squirrel monkey  agaag---ag
         Chinese tree shrew  aaagg---ag
B D                Squirrel  agatg-----
     Lesser Egyptian jerboa  agcag-----
               Prairie vole  agtgg-----
B D         Chinese hamster  agtgg-----
B D                   Mouse  agtgg-----
B D                     Rat  agtag-----
                 Chinchilla  actttg----
B D                  Rabbit  atagg-ag--
B D                     Pig  agagg---ag
B D                  Alpaca  agagg---aa
             Bactrian camel  agagg---ag
B D                 Dolphin  agagg---ag
               Killer whale  agagg---ag
           Tibetan antelope  agagg---ag
B D                     Cow  agagg---ag
B D                   Sheep  agagg---ag
              Domestic goat  agagg---ag
B D                   Horse  agaag---ag
B D        White rhinoceros  agggg---ag
B D                     Cat  agaga---ac
B D                     Dog  agagg---ac
B D                 Ferret   agagg---ac
B D                   Panda  agaga---ac
             Pacific walrus  agagg---ac
               Weddell seal  agagg---ac
           Black flying-fox  aaaga---ag
B D                 Megabat  aaaga---ag
B D                Hedgehog  agaag---gc
B D                   Shrew  aagag---ac
            Star-nosed mole  aagtg---ac
B D                Elephant  agaaa---ag
B D                 Manatee  ggaag---ag
           Cape golden mole  aaagg---aa
B D                  Tenrec  agagg---ac
                   Aardvark  aaagg---ag
B D               Armadillo  ccagg---aa
            Golden hamster  ==========
B D                    Pika  ----------
B D          Naked mole-rat  ==========
       Cape elephant shrew  ==========
          Brush-tailed rat  ==========
B D              Guinea pig  ==========
  D             Rock pigeon  ==========
B D         Tasmanian devil  ==========
B D                 Opossum  ==========
      David's myotis (bat)  ==========
B D                Bushbaby  ==========

Inserts between block 16 and 17 in window
B D                 Rabbit 1bp
B D                    Pig 1bp
B D                 Alpaca 1bp
            Bactrian camel 1bp
B D                Dolphin 1bp
              Killer whale 1bp
          Tibetan antelope 1bp
B D                    Cow 1bp
B D                  Sheep 1bp
             Domestic goat 1bp
B D                    Cat 1bp
B D                    Dog 1bp
B D                Ferret  1bp
B D                  Panda 1bp
            Pacific walrus 1bp
              Weddell seal 1bp
          Black flying-fox 1bp
B D                Megabat 1bp
B D               Hedgehog 1bp
B D                  Shrew 1bp
           Star-nosed mole 1bp

Alignment block 17 of 713 in window, 31658143 - 31658143, 1 bps 
B D                   Human  t
B D                   Chimp  t
B D                 Gorilla  t
B D                  Gibbon  t
B D                  Rhesus  t
B D     Crab-eating macaque  t
B D                  Baboon  t
B D            Green monkey  t
B D                Marmoset  t
B D         Squirrel monkey  t
         Chinese tree shrew  t
B D                Squirrel  t
     Lesser Egyptian jerboa  g
               Prairie vole  t
B D         Chinese hamster  c
B D                   Mouse  t
B D                     Rat  t
B D              Guinea pig  t
                 Chinchilla  t
B D                Elephant  c
B D                 Manatee  a
           Cape golden mole  c
B D                  Tenrec  c
                   Aardvark  c
B D               Armadillo  c
B D                Hedgehog  =
            Golden hamster  =
B D                    Pika  -
           Star-nosed mole  =
B D                   Shrew  =
B D                  Rabbit  =
B D          Naked mole-rat  =
       Cape elephant shrew  =
          Brush-tailed rat  =
B D                 Dolphin  =
B D                 Megabat  =
B D                     Pig  =
              Weddell seal  =
  D             Rock pigeon  =
B D         Tasmanian devil  =
B D                 Opossum  =
              Killer whale  =
            Bactrian camel  =
B D                   Sheep  =
B D                     Cow  =
          Tibetan antelope  =
          Black flying-fox  =
      David's myotis (bat)  =
B D                     Dog  =
             Domestic goat  =
B D                  Alpaca  =
            Pacific walrus  =
B D                   Panda  =
B D                 Ferret   =
B D                     Cat  =
B D        White rhinoceros  -
B D                   Horse  -
B D                Bushbaby  =
B D               Orangutan  -

Alignment block 18 of 713 in window, 31658144 - 31658148, 5 bps 
B D                   Human  aattc
B D                   Chimp  aattc
B D                 Gorilla  aattc
B D                  Gibbon  aattc
B D                  Rhesus  aattc
B D     Crab-eating macaque  aattc
B D                  Baboon  aattc
B D            Green monkey  aattc
B D                Marmoset  aattc
B D         Squirrel monkey  aattc
         Chinese tree shrew  aactc
B D                Squirrel  aactt
     Lesser Egyptian jerboa  aactc
               Prairie vole  ga-tc
B D         Chinese hamster  aa-gc
B D                   Mouse  aa-tc
B D                     Rat  aa-tc
B D          Naked mole-rat  aactc
B D              Guinea pig  aagtc
                 Chinchilla  aactc
B D                  Rabbit  gactt
B D                     Pig  ggctc
B D                  Alpaca  gactc
             Bactrian camel  gactc
B D                 Dolphin  gactc
               Killer whale  gactc
           Tibetan antelope  aaccc
B D                     Cow  aacct
B D                   Sheep  aaccc
              Domestic goat  aaccc
B D                   Horse  -actt
B D        White rhinoceros  --ctc
B D                     Cat  aagcc
B D                     Dog  aactc
B D                 Ferret   aactc
B D                   Panda  aactc
             Pacific walrus  aactc
               Weddell seal  aactc
           Black flying-fox  aactg
B D                 Megabat  aactg
B D                Hedgehog  cagtc
B D                   Shrew  cgctc
            Star-nosed mole  aactc
B D                Elephant  aactt
B D                 Manatee  aactc
           Cape golden mole  atctc
B D                  Tenrec  aaccc
                   Aardvark  aactc
B D               Armadillo  aactc
            Golden hamster  =====
B D                    Pika  -----
       Cape elephant shrew  =====
          Brush-tailed rat  =====
  D             Rock pigeon  =====
B D         Tasmanian devil  =====
B D                 Opossum  =====
      David's myotis (bat)  =====
B D                Bushbaby  =====
B D               Orangutan  -----

Alignment block 19 of 713 in window, 31658149 - 31658205, 57 bps 
B D                   Human  a-ctgtc--ccaaagcagct---ctctcgtgtctgtg----------------ggcggatcccttggcaa
B D                   Chimp  a-ctgtc--ccaaagcagct---ctctcgtgtctgtg----------------ggcggctcccttggcaa
B D                 Gorilla  a-ctgtc--ccaaagcagct---ctctcgtgtctgtg----------------gtcggctcccttggcaa
B D               Orangutan  --ctgtc--ccaaagcagct---ctctcgggtctgtg----------------ggcggctcccttggcaa
B D                  Gibbon  a-ctgtc--ccaaagcagct---ctctcgtgtctgtg----------------ggcggctcccttggcaa
B D                  Rhesus  a-ctgtc--ccaaagcagcg---ctcttgtgtctgtg----------------ggcggctcccttggcaa
B D     Crab-eating macaque  a-ctgtc--ccaaagcagcg---ctcttgtgtctgtg----------------ggcggctcccttggcaa
B D                  Baboon  a-ctgtc--ccaaagcagcg---ctcttgtgtctgtg----------------ggcggctcccttggcaa
B D            Green monkey  a-ctgtc--ccaaagcagcg---ctcttgtgtctgtg----------------ggcggctcccttggcaa
B D                Marmoset  a-ccgtc--ccaaagca--g---ctctcgtgtcgacg----------------ggtggctcccttggcaa
B D         Squirrel monkey  a-ctgtt--ccaaagc---t---ctcttgtgtcgacg----------------ggtggctcccttggcaa
         Chinese tree shrew  a-cggtg--ccaaggcagtt---c-ctcctaactgca------------------ctgcttcctcagcaa
B D                Squirrel  a-ttgtc--ccaaagtggcc---cc-ttgtatccttg----------------gtttgttttcttggcaa
     Lesser Egyptian jerboa  a-ctg----agagagcagct---ct-ttgtacccg-g----------------gcctgccttcttggcaa
               Prairie vole  a-ttgtt--ccagggaggcc---ct-ttgtacccatg----------------gcctgctttcttggcaa
B D         Chinese hamster  t-ttgtc--tgagggaggcc---cc-ttatccctatg----------------gcctgctttcttggcaa
B D                   Mouse  a-ttgtt--tgaggaaggcc---ct-ttgtacccatg----------------gcctgctttctcggcgg
B D                     Rat  a-ttgtc--tgagggaggcc---ct-ttgtacccatg----------------gcctgctttctcggcag
B D          Naked mole-rat  a-gtatc--ccag-gcggct---ct-ttctgtctgtg----------------agctgtgttcttggcaa
B D              Guinea pig  a-ctatc--tgaaggcagct---tt-ttatatctgtg----------------agctgccttcttggcaa
                 Chinchilla  a-ctgtc--ctaacgcagct---ct-tcgtatctgtg----------------agctgtgatcttggcaa
           Brush-tailed rat  a-ctatc--agagcgcagtt---ct-ttgtatccatg----------------agctgcattcttggcaa
B D                  Rabbit  --------------gctgccctgct-ctgtatccgcg----------------ggctgctctcctggcac
B D                    Pika  -----------------------ct-gaatgtctcaa----------------ggctggtt---------
B D                     Pig  actgatc--ccagggtcact---ct-tcgaacccttg----------------ggcaactttgctggcaa
B D                  Alpaca  a-cgatc--ccagggccact---tt-ttgtattcgtg----------------ggctgctttgttggcaa
             Bactrian camel  a-tgatc--ccagggcccct---tt-ttgtattcgtg----------------ggctgctttgttggcaa
B D                 Dolphin  a-gggtc--ccagggccac-----t-ctgta--catg----------------ggctgctttgttggcca
               Killer whale  a-gggtc--ccagggccac-----t-ctgta--catg----------------ggctgctttgttggcca
           Tibetan antelope  --agatg--ccagcacca--------ttgca--cctg----------------gggtagtttgttggcat
B D                     Cow  --ggatc--ccagcacca--------ctgca--catg----------------gggtagattgttggcat
B D                   Sheep  --ggatc--ccagcacca--------ttgca--cgtg----------------gggtagcttgttggcat
              Domestic goat  --ggatc--ccagcacca--------ttgca--cgtg----------------gggtagcttgttggcat
B D                   Horse  a-atgtc--ccagggccact---ct-ttgtatccgtg----------------gtcagcctcagtgccaa
B D        White rhinoceros  a-atgtc--ccagggccact---ct-ttgtatccgtg----------------gtctgcctcgttggcaa
B D                     Cat  c-ctgtc--ccag-gccgtt---ct-ttgcatccatgggctggctggttcgggggctggatccttgccaa
B D                     Dog  t-ctgtc--tcagggtcact---ct-ttgtatccatg----ggttggcccctgggctggtgctttggcag
B D                 Ferret   c-ctgac--ctagggctgct---ct-ttgtatccagg----ggttggtccctgggctggtccgctggcaa
B D                   Panda  c-ctgtc--ccagggctgct---ct-ttgtatccagg----ggttggtccctgggctggtcccctggcaa
             Pacific walrus  c-ctgtc--ccagagctgct---ct-ttgtatccagg----agttggtccctgggctggtcccctggcca
               Weddell seal  c-ctgtc--ccaggg--------ct-ttgcatccagg----ggttggtccctgggctggtcccctggcaa
           Black flying-fox  c-ctggc--ccaaggcagct---ct-ttgtaagtgag------------------ctgcgcagttggcaa
B D                 Megabat  c-ctggc--ccaaggcagct---ct-ttgtaagtgag------------------ctgcgcagttggcaa
B D                Hedgehog  c-aggcttgtcagggaggtt---ct-ttgtagctgtg----------------ggttgatctgtcaacga
B D                   Shrew  c-cgcct--ccagggcgtct---ct-ctgggaccatg--------------------gctttgctgacaa
            Star-nosed mole  c-ctgtc--ccagggaagct---ct-ctgtacctctg----------------gactgcttggcctgcaa
B D                Elephant  --ctctc--ccaaggcagct---ct-cagtatct-tg----------------ggctgctctggcggcaa
B D                 Manatee  --ctctc--ctgaggcagct---ct-caggatct-tg----------------ggcggctttggcagcaa
           Cape golden mole  --aaata--ccaagtcagct---ct-ttgtatcc-tg----------------ggctgctttggcagcaa
B D                  Tenrec  --ctgtt--ccacggcag-t---tt-tcatatca-cg----------------ggctgctttggcagcaa
                   Aardvark  --ctgtt--ccaacacagct---ct-ttgtatca-tg----------------gactgctctggcagcaa
B D               Armadillo  a-ctgtc--ctgggccatct---ct-taggatgt-gt----------------ggctgctctatcggcaa
            Golden hamster  ======================================================================
       Cape elephant shrew  ======================================================================
  D             Rock pigeon  ======================================================================
B D         Tasmanian devil  ======================================================================
B D                 Opossum  ======================================================================
      David's myotis (bat)  ======================================================================
B D                Bushbaby  ======================================================================

                      Human  gt--ttacaat
                      Chimp  gt--ttacaat
                    Gorilla  gt--ttacaat
                  Orangutan  gt--ttacaat
                     Gibbon  gt--tcacaat
                     Rhesus  gt--ttacaat
        Crab-eating macaque  gt--ttacaat
                     Baboon  gt--ttacaat
               Green monkey  gt--ttacaat
                   Marmoset  gt--ttacaat
            Squirrel monkey  ga--ttacaat
         Chinese tree shrew  gt--ttacaat
                   Squirrel  gt--ttacaat
     Lesser Egyptian jerboa  gt--ttacaat
               Prairie vole  gt--ttagaat
            Chinese hamster  gt--ttacaat
                      Mouse  gt--tgacaat
                        Rat  gt--ttacaat
             Naked mole-rat  gt--cgacaat
                 Guinea pig  gt--ttacaac
                 Chinchilla  gt--ttacaat
           Brush-tailed rat  at--ttacagt
                     Rabbit  gt--ttacaat
                       Pika  -c--tgacaac
                        Pig  gt---------
                     Alpaca  gt---------
             Bactrian camel  gt---------
                    Dolphin  gc---------
               Killer whale  gc---------
           Tibetan antelope  gt---------
                        Cow  gt---------
                      Sheep  gt---------
              Domestic goat  gt---------
                      Horse  gc--tctc-cc
           White rhinoceros  gc--tctc-cc
                        Cat  gt--actc-cc
                        Dog  gt--tcat-ac
                    Ferret   gt--tcat-ac
                      Panda  gt--tcat-ac
             Pacific walrus  gc--tcat-at
               Weddell seal  gc--tcat-at
           Black flying-fox  gt--tctc-at
                    Megabat  gt--tctc-ag
                   Hedgehog  ac--tctc-at
                      Shrew  gt--acttggc
            Star-nosed mole  gt--tctc-ac
                   Elephant  gatcttataac
                    Manatee  gatcttaccac
           Cape golden mole  gttcttacaat
                     Tenrec  gttcttacatc
                   Aardvark  gttcttgtaac
                  Armadillo  gttctcacaat
             Golden hamster  ===========
        Cape elephant shrew  ===========
                Rock pigeon  ===========
            Tasmanian devil  ===========
                    Opossum  ===========
       David's myotis (bat)  ===========
                   Bushbaby  ===========

Inserts between block 19 and 20 in window
B D                  Horse 3bp
B D       White rhinoceros 3bp
B D                    Cat 3bp
B D                    Dog 3bp
B D                Ferret  3bp
B D                  Panda 3bp
            Pacific walrus 3bp
              Weddell seal 3bp
          Black flying-fox 2bp
B D                Megabat 2bp
B D               Hedgehog 3bp
B D                  Shrew 3bp
           Star-nosed mole 3bp

Alignment block 20 of 713 in window, 31658206 - 31658207, 2 bps 
B D                   Human  ga
B D                   Chimp  ga
B D                 Gorilla  ga
B D               Orangutan  ga
B D                  Gibbon  ca
B D                  Rhesus  ga
B D     Crab-eating macaque  ga
B D                  Baboon  ga
B D            Green monkey  ga
B D                Marmoset  ga
B D         Squirrel monkey  ga
         Chinese tree shrew  ga
B D                Squirrel  ga
     Lesser Egyptian jerboa  ga
               Prairie vole  ga
B D         Chinese hamster  ga
B D                   Mouse  ga
B D                     Rat  gg
B D          Naked mole-rat  ga
B D              Guinea pig  aa
                 Chinchilla  ga
           Brush-tailed rat  ga
B D                  Rabbit  ga
B D                    Pika  ca
B D                     Pig  ga
B D                  Alpaca  ga
             Bactrian camel  ga
B D                 Dolphin  ga
               Killer whale  ga
           Tibetan antelope  ga
B D                     Cow  ga
B D                   Sheep  ga
              Domestic goat  ga
B D                   Horse  ga
B D        White rhinoceros  ga
B D                     Cat  ga
B D                     Dog  ga
B D                 Ferret   ga
B D                   Panda  ga
             Pacific walrus  ga
               Weddell seal  ga
           Black flying-fox  ga
B D                 Megabat  ga
              Big brown bat  ga
B D                Hedgehog  ag
B D                   Shrew  ta
            Star-nosed mole  ga
B D                Elephant  ca
B D                 Manatee  aa
           Cape golden mole  ca
B D                  Tenrec  aa
                   Aardvark  ta
B D               Armadillo  ga
            Golden hamster  ==
       Cape elephant shrew  ==
  D             Rock pigeon  ==
B D         Tasmanian devil  ==
B D                 Opossum  ==
      David's myotis (bat)  ==
B D                Bushbaby  ==

Alignment block 21 of 713 in window, 31658208 - 31658363, 156 bps 
B D                   Human  actgaaat---ctgc----cg----aacttcctg-------gaacccaa--agaaactttagccttgggc
B D                   Chimp  actgaaat---ctgc----cg----aacttcctg-------gaacccaa--agaaactttagccttgggc
B D                 Gorilla  actgaaat---ctgc----cg----aacttcctg-------gaacccaa--agaaactttagccttgggc
B D               Orangutan  actgaaat---ctgc----cg----aacttcctg-------gaacccaa--agaaacttcagccttgggc
B D                  Gibbon  actgaaat---ctgc----cg----aacttcctg-------gaacccaa--agaaacttcagccttgggc
B D                  Rhesus  actgaact---cggc----ca----aacttcctg-------gaacccag--agaaacttcagccttgggc
B D     Crab-eating macaque  actgaact---cggc----ca----aacttcctg-------gaacccag--agaaacttcagccttgggc
B D                  Baboon  actgaact---cggc----ca----aacttcctg-------gaacccag--agaaacttcagccttgggc
B D            Green monkey  actgaact---ctgc----ca----aacttcctg-------gaacccag--agaaacttcagccttgggc
B D                Marmoset  actgaaat---ctgc----tg----aacttcctg-------gaacccaa--agaaacttcagccttgggc
B D         Squirrel monkey  actgaaat---ctgc----tg----aacttcctg-------gaacccaa--agaaacttcagccttgggc
         Chinese tree shrew  actgagat---ctgc----cactctaacttcctg-------gaacccaa--agaaactttggccttggtc
B D                Squirrel  cctgcaat---ctaccttcct----cacttcctg-------gaatgcaa--agaaacttcggccttgggc
     Lesser Egyptian jerboa  actgaaat---ccac----ct----aacttcctg-------gaacccaa--agcaagttcagccttgggc
               Prairie vole  actgaaac---ccaa--ctct----gacttcctg-------gaacccaa--aggaagtctggctttgggc
B D         Chinese hamster  actgaaat---ccaa--ctct----aacttcccg-------gaacccaa--agaaagtctggctttgggc
B D                   Mouse  actgaaat---ccaa--ccct----aacttcctg-------gaacccaa--agaaagtctggctttggac
B D                     Rat  actgaaat---ccaactctct----aacttcctg-------gaacccaa--agaaagtctggctttggac
B D          Naked mole-rat  agtgaact---ctgc----ct----aacttcctg-------gaacccta--agaaacttcagcctcggac
B D              Guinea pig  agcgaaattcattgc----tg----aacttcctg-------gaacccaa--agaaactctgacctcgggc
                 Chinchilla  agtgaaat---ctgc----cc----aacttcctg-------gaacccaa--agaaactttgaccttgggc
           Brush-tailed rat  agtgaaat---ctg-----cc----aactttttg-------gaagctga--agaaacttgggccttgggc
B D                  Rabbit  accgaaat---ctccctctcg----aacttcctt-------gaacccta--agaaccttcggcccagggc
B D                    Pika  actgaaat---ctgtcttttg----aactttctg-------gaacccag--agaaacttcagcccagagc
B D                     Pig  actgaaat---ctga--ttcc----aacttctta-------gaacccaa--aggaactttggccttgggc
B D                  Alpaca  actgaaat---ctga--ttcc----aacttccaa-------gaacccaa--agaaacttcagccttgggc
             Bactrian camel  actgaaat---ctga--ttcc----aacttccaa-------gaacccaa--agaaacttcagccttgggc
B D                 Dolphin  actgaaat---ctga--ttcc----aacttcctggaattttgaagccaaagagaaactctggccttgggc
               Killer whale  actgaaat---ctga--ttcc----aacttcctggaattttgaagccaaagagaaactctggccttgggc
           Tibetan antelope  actgaaac---ctga--ttcc----aacttcctg-------gaagccaa--agaaactttggccttgggc
B D                     Cow  actgaaat---ctga--ttcc----aacttcctg-------gaagccaa--agagactttggccttgggc
B D                   Sheep  actgaaat---ctga--ttcc----aacttcctg-------gaagccaa--agaaactttggccttgggc
              Domestic goat  actgaaat---ctga--ttcc----aacttcctg-------gaagccaa--agaaactttggccttgggc
B D                   Horse  actgaaat---ctga--ctctc---aacttcctg-------gaacccaa--agaaactgcggccttgggc
B D        White rhinoceros  actgaaat---ctca--ctct----aacttcctg-------aaacccaa--agaaactttggccttgggc
B D                     Cat  actgaaac---ctga--gtctct--aacttcctg-------gaacccaa--agaaacttagaccttgagc
B D                     Dog  actgaaac---ctga--ctccct--aacttcctg-------gaacccaa--agaaacttagaccttgggc
B D                 Ferret   actgaaac---caga--ctctct--cacttcctg-------gaacccaa--agaaacttagaccttgggc
B D                   Panda  actgaaac---ccaa--ctctct--aacttcctg-------gaacacaa--agaaacttagaccttgggc
             Pacific walrus  actgaaac---ctga--ctttct--aatttcctg-------gaacccaa--agaaacttagaccttgggc
               Weddell seal  actgacac---ctga--ctctct--aacttcctg-------gaacccaa--agaaaattagaccttgggc
           Black flying-fox  actgaaat---ctga--ctct----aagttcctg-------aaacccaa--agaaacttcggccttgggc
B D                 Megabat  actgaaat---ctga--ctct----aacttcctg-------aaacccaa--agaaacttcggccttgggc
              Big brown bat  actgaaat---ccgg--ctct----gacttcctg-------aaaccc-----gaaaccttggcctcgggc
       David's myotis (bat)  actgaaat---ccgg--ctcc----cacttcctg-------aaacccga--agaaaccttggcctcgggc
B D                Hedgehog  actgaaat---cca----acc----aacttcctg-------gaatccag--agaaactttggtctagggc
B D                   Shrew  actgaaa-----------tct----gatttcctg-------gaactcag--agaaacttcggccttgagc
            Star-nosed mole  actgaaat---taaa--ctct----cacttcctg-------gagcccaa--agaagctttggccttgggc
B D                Elephant  actgaaat---ttgc--ttct----gacttcctg-------gaactgaa--agaaactctggacttgggt
B D                 Manatee  gctgaaat---ctgc--tgct----gacttcctg-------gaacccaa--agaagcttcggacttgggc
           Cape golden mole  gccgaaat---ctgc--ttct----gatttcctg-------gaacccaa--agaaactttagacttggac
B D                  Tenrec  actgtaat---ctgc--gtct----gactttctg-------aaccccaa--agcaactttagtcttgggc
                   Aardvark  actgaaat---ctgc--ttct----gacttccta-------gaacccaa--agaaactttggacttggga
B D               Armadillo  actgagac---gggt--ttctcc--agcttcctg-------gaacccaa--agaaactctgaccttgagc
            Golden hamster  ======================================================================
       Cape elephant shrew  ======================================================================
  D             Rock pigeon  ======================================================================
B D         Tasmanian devil  ======================================================================
B D                 Opossum  ======================================================================
B D                Bushbaby  ======================================================================

                      Human  aaaggccctttgg-cc--agcatt--tgcactgtttatgc---aac-c---gtttagaat--atacgaat
                      Chimp  aaaggccctttgg-cc--agcatt--tgcactgtttatgc---aac-c---gtttagaat--atacgaat
                    Gorilla  aaaggccctttgg-cc--agcatt--tgcactgtttatgc---aac-c---gtttagaat--atacgaat
                  Orangutan  aaaggccgtttgg-cc--agcatt--tgcactgtttatgc---aat-c---gtttagaat--atacgaat
                     Gibbon  aaaggccgtttgg-cc--agcatt--tgcactgtttatgc---aac-c---gtttagaat--atacgaat
                     Rhesus  aaaggccgtttgg-cc--agcatt--tgcactgtttatgc---aac-c---gtttagaat--atacgaat
        Crab-eating macaque  aaaggccgtttgg-cc--agcatt--tgcactgtttatgc---aac-c---gtttagaat--atacgaat
                     Baboon  aaaggccgtttgg-cc--agcatt--tgcactgtttatgc---aac-c---gtttagaat--atacgaat
               Green monkey  agaggccgtttgg-cc--agcatt--tgcactgtttatgc---aac-c---gtttagaat--atacgaat
                   Marmoset  aaaggccatttgg-ca--agcgtt--tgaactgtttatgt---aac-c---gtctagaat--atactaat
            Squirrel monkey  aaaggccatttgg-cc--agcatt--tgcactgtttatgt---aac-c---gtctagaat--atactaaa
         Chinese tree shrew  aaatgccctttgg-ca--ggtatt--tgcaa-gcttacat---aat-t---ctctagcat--gtgccagt
                   Squirrel  aaaggccctttgg-cc--agcatt--gg---catttatgt---aac-t---gtctagcat--atgcaagt
     Lesser Egyptian jerboa  aaaggccttttgg-ct--ggcatt--tg---tgcttatgt---aac-t--gttttaatatatatgcaagc
               Prairie vole  aaaggccctttgg-ct--gggatt--tg---tgtttatgt---aac-t---ctccagtatatacgcaagt
            Chinese hamster  aaaggccgtttgg-ct--gggatg--tg---tgcttatgt---aac-t---cttcagtgtgcgggcaagt
                      Mouse  aaaggccctttgg-ct--gggatt--tg---tgcttatgt---aac-t---cttcagtatacatgcaagt
                        Rat  aaaggccctttgg-ct--gggatt--tg---tgcttatgt---aat-t---cttccgtatgcatgcaagt
             Naked mole-rat  aaaggccctttgg-ct--ggcatt--tg---cgcttatgt---aac-t---gtttaccac--atgctagt
                 Guinea pig  aaaacctttttgg-ct--ggcatt--tg---tttttaggt---aac-t---gtttatcat--atgctaat
                 Chinchilla  aaaagccctttgg-ct--ggcatg--tg---tacttaggt---aac-t---gtttagcac--atgctaat
           Brush-tailed rat  aggagcccttcgg-ct--ggcatt--tt---cacataggt---aac-t---gtttagcat--g---caat
                     Rabbit  aaaggccctttgg-ca--ggcatttgtg---tgcttatgc---aag-g---gcctagcat--gttccagg
                       Pika  aaaggccctttgg-ca--ggcatgtatg---tgcttatgcaagaag-g---ttctagtat--attccagg
                        Pig  aaaggccctttgg-cc--cggatt--tgca-catttatgt---aac-c---gccag-cac--atgtcagt
                     Alpaca  aaaggccctttgg-ct--gatatt--ggca-catttatgc---aac-t---gcctagcct--atgccaat
             Bactrian camel  aaaggccctttgg-ct--gatatt--ggca-catttatgc---aac-t---gcctagcct--atgccaat
                    Dolphin  aaagaccctgtgg-ct--ggaatt--tgca-catttatgc---aat-t---gcctagcac--aagtcagc
               Killer whale  aaagaccctgtgg-ct--ggaatt--tgca-catttatgc---aat-t---gcctagcac--aagtgagc
           Tibetan antelope  aaaggccttttgg-ct--gcgatc--tgca-catttatgc---aac-t---------tac--a----ggc
                        Cow  aaaggacctttgg-ct--gtgatt--tgca-catttatgc---aac-g---------tac--a----ggc
                      Sheep  aaaggccttttgg-ct--gtgatc--tgca-catttatgc---aac-t---------tac--a----ggc
              Domestic goat  aaaggccttttgg-ct--gtgatc--tgca-catttatgc---aac-t---------tac--a----ggc
                      Horse  aaaggccttttgg-ct--ctcact--tgca-catttatgc---aac-t---gtctagcac--atgccagt
           White rhinoceros  aaaggcc-tttgg-ct--ggcatc--cgca-catttatgc---aac-t---gcctagcat--atgccagt
                        Cat  aaaggccctttgg-ct--ggcatg--caca-catttatcc---aac-tctctattggcat--atgc----
                        Dog  aaaggccctttgg-ct--agcatt--tgca-catttatgc---aac-t---tactagtat--gtgccaat
                    Ferret   aaaggccctttgg-ct--agcatt--tgca-catttatgc---aac-t---tagtagcat--atgccaat
                      Panda  aaaggccttttag-ct--agcatt--tgca-catttatga---aac-t---tactagcat--atgccaat
             Pacific walrus  aaaggccctttgg-ct--agcatt--tgca-catttatgc---aac-t---tactagcat--acgccaat
               Weddell seal  aaaggccctctgg-ct--agcatt--tgca-catttatgc---aac-t---tactagcat--acaccaat
           Black flying-fox  aaaggccttttgg-ct--ggcatt--tgca-ggtttatgc---aac-a---gactagcat--ctctcagt
                    Megabat  aaaggccttttgg-ct--ggcatt--tgca-ggtttatgc---aac-a---gactagcat--ctctcagt
              Big brown bat  aaaggccctttgg-cc----------ggca-ggtttatgc---aac-a---gggcagc-t--gtgccag-
       David's myotis (bat)  aaaggccctttgg-cc--ggcact--ggca-ggcttatgc---aac-a---ggcggcc-t--gtgccag-
                   Hedgehog  aaaggccctttga-tt--ggcatt--gacc-catttttgc---aac-t---gccaggcac--gtgccagg
                      Shrew  aaagg-cctctga-ct--gccatt--tcca-catctatgc---cacag---actagccgt--gggccagt
            Star-nosed mole  aaaggtcctttgg-ct--gcttct--tgaa-catttatgc---aac----------ctcc--gggc----
                   Elephant  aaaggccatttgg-ctgtactagt--tgca-tgtttatgc---aac-t---gtgtagcat--gtgccagt
                    Manatee  aaaggccgtttggtcagtactatt--tgca-tgtttatac---aac-t---gcgtagcat--gtgccaat
           Cape golden mole  aaaggccgtttgg-ca--agtatt--tgca-agtttatgc---aac-t---ttctagcat--atgccagt
                     Tenrec  aaaggccacttgg-ca--agtatt--tgga-agtttatat---aat-g---gcctagcat--attctagt
                   Aardvark  aaaggccatttgg-cc--aatgtt--tgca-agtttatac---aac-t---gtctagcat--atgccagt
                  Armadillo  aaaggccctttgg-ct--aggatt--tgca-ggtttatgc---aac-t---gtctggcag--atgccaac
             Golden hamster  ======================================================================
        Cape elephant shrew  ======================================================================
                Rock pigeon  ======================================================================
            Tasmanian devil  ======================================================================
                    Opossum  ======================================================================
                   Bushbaby  ======================================================================

                      Human  t-atctg----gaga---ctactac-ca---------------aat-ac-aacagg--------------
                      Chimp  t-atctg----gaga---ctactac-ca---------------aat-ac-aacagg--------------
                    Gorilla  t-atctg----gagg---ctactac-ca---------------aat-ac-aacagg--------------
                  Orangutan  t-atctg----gaga---ctactac-ta---------------aat-ac-aacagg--------------
                     Gibbon  t-atctg----gaga---ctactac-ta---------------aat-ac-aacatg--------------
                     Rhesus  t-atctg----gaaa---ctactac-ta---------------aat-ac-aacacg--------------
        Crab-eating macaque  t-atctg----gaaa---ctactac-ta---------------aat-ac-aacacg--------------
                     Baboon  t-atctg----gaaa---ctactac-ta---------------aat-at-aacacg--------------
               Green monkey  t-atctg----gaaa---ctacgac-ta---------------act-ac-aacacg--------------
                   Marmoset  t-atctg----gaaa---ctact----a---------------aat-ac-aacaag--------------
            Squirrel monkey  t-gtctg----taaa---ctact----a---------------aat-ac-aacaag--------------
         Chinese tree shrew  t-agctg----gaaa---acaccag-ca---------------cat-tc-aa---g--------------
                   Squirrel  tcatctg----gtga---atactag-taagtcacactttctagagg-at-g---ac--------------
     Lesser Egyptian jerboa  t-atctg----gaga---atactgg-ta---------------agg-at-aacaag--------------
               Prairie vole  t-atctg----gaga---acgctaa-ta---------------aca-at-t---ga--------------
            Chinese hamster  t-acctg----gaga---atactaa-ta---------------acg-gt-g---ga--------------
                      Mouse  t-atctg----gaga---atactag-tg---------------aga-at-agc-at--------------
                        Rat  c-atctg----gaga---atactag-tg---------------aga-at-a---ag--------------
             Naked mole-rat  t-atctg----gaga---atactag-ta---------tcct--aat-ac-cct-agaactgcactagtgc
                 Guinea pig  t-atctg----gaga---atattag-tg---------------aac-ac-aac-ag--------------
                 Chinchilla  t-atctg----gaga---atattag-ta---------------aat-ac-aac-ag--------------
           Brush-tailed rat  t-atctg----gaga---atgctag-ta---------------aat-ac-aac-ag--------------
                     Rabbit  c-acctg----caga---acaccag-aa---------------aga-ac-cacaag--------------
                       Pika  c-cgctg----gatc---acaccag-aa---------------agctat-cacagg--------------
                        Pig  t-atctg----gaaa---atgctag-ga---------------agt-ac----aag--------------
                     Alpaca  t-atctg----gaaa---atgctag-ta---------------agt-ac-aataag--------------
             Bactrian camel  t-atctg----gaaa---atgctag-ta---------------agt-ac-aataag--------------
                    Dolphin  t-atctg----ggaa---atgctag-ta---------------agt-ac-aacaag--------------
               Killer whale  t-atctg----ggaa---atactag-ta---------------agt-ac-aacaag--------------
           Tibetan antelope  t-aacta----gaaa---atgctagttg---------------agt-ac-aacaag--------------
                        Cow  t-aacta----gaaa---atgctagttg---------------agt-ac-aacaag--------------
                      Sheep  t-aacta----gaaa---atgctagttg---------------agt-ac-aacaag--------------
              Domestic goat  t-aacta----gaaa---atgctagttg---------------agt-ac-aacaag--------------
                      Horse  t-atctg----gaga---atactag-ta---------------agt-tc-aacaag--------------
           White rhinoceros  t-atctg----gaga---atgctag-ta---------------agt-ac-aacaag--------------
                        Cat  ----ctg----gaga---atactag-ta---------------agt-at-acgcag--------------
                        Dog  t-atctg----gaga---atactag-ta---------------agt-ac-aagcag--------------
                    Ferret   t-atctg----gaga---atactag-ta---------------agt-ac-aagcag--------------
                      Panda  t-accta----gaga---atactag-ta---------------agt-ac-aagcag--------------
             Pacific walrus  t-atctg----gaga---atactag-ta---------------ggt-ac-aagcag--------------
               Weddell seal  t-atctg----gcga---atactag-ta---------------agt-ac-aagcag--------------
           Black flying-fox  t-atctg----gaaa---gtgctagttg---------------agt-ac-aacatg--------------
                    Megabat  t-atctg----gaaa---gtgctagttg---------------agt-ac-aacatg--------------
              Big brown bat  ---gccg----gaga---gc--------------------------------------------------
       David's myotis (bat)  ---gctg----gaga---gcgc----tg---------------ggg-cc-cgcggg--------------
                   Hedgehog  t-accca----gagacagagtgcac-g------------------t-gc-caaaag--------------
                      Shrew  t-attgg----caaacaaacgctgg-gg---------------aga-gc-tgggag--------------
            Star-nosed mole  ------------------atggcag-ga---------------act-ac-aacaag--------------
                   Elephant  t-atctg----gaaa---atactag-aa---------------ggt-ac-aacaag--------------
                    Manatee  t-atctg----gaaa---atactag-aa---------------ggt-----acaag--------------
           Cape golden mole  t-atatg----gaga---atgctag-a-------------------------------------------
                     Tenrec  t-atctgctacgaaa---atgctaa-aa---------------gcc-tc-aaccca--------------
                   Aardvark  t-atctg----gaga---ataccag-aa---------------ggc-ac-aacaag--------------
                  Armadillo  t-gtctg----cagc---atactaa-ta---------------gat-actaacaag--------------
             Golden hamster  ======================================================================
        Cape elephant shrew  ======================================================================
                Rock pigeon  ======================================================================
            Tasmanian devil  ======================================================================
                    Opossum  ======================================================================
                   Bushbaby  ======================================================================

                      Human  ------caaaac----------------------------tgcaa-------------------------
                      Chimp  ------caaaac----------------------------tgcaa-------------------------
                    Gorilla  ------caaaac----------------------------tgcaa-------------------------
                  Orangutan  ------caaaac----------------------------tgcaa-------------------------
                     Gibbon  ------caaaac----------------------------tgcaa-------------------------
                     Rhesus  ------caaaac----------------------------tgcaa-------------------------
        Crab-eating macaque  ------caaaac----------------------------tgcaa-------------------------
                     Baboon  ------caaaac----------------------------tgcaa-------------------------
               Green monkey  ------caaaac----------------------------tgcaa-------------------------
                   Marmoset  ------caaaac----------------------------tacaa-------------------------
            Squirrel monkey  ------caaaac----------------------------tacaa-------------------------
         Chinese tree shrew  ------taaaat----------------------------tataa-------------------------
                   Squirrel  ------aaatatgaattgtgtgtctctgac----------aacagatgcattagatttcaagggcctaa-
     Lesser Egyptian jerboa  ------caagat----------------------------cacag-------------------------
               Prairie vole  ------aac-------------------------------cacagac-----------------------
            Chinese hamster  ------aaccacaga-tgcatacgccatccttctatctgacacagactcaccaaa---caacagttttaa
                      Mouse  ------catagt----------------------------cacagaat----------------------
                        Rat  ------gacaac----------------------------cacag-------------------------
             Naked mole-rat  cctagtgcaaat----------------------------tacaa-------------------------
                 Guinea pig  ------gcaaat----------------------------tataa-------------------------
                 Chinchilla  ------gcaaat----------------------------tataa-------------------------
           Brush-tailed rat  ------gcaaat----------------------------tataa-------------------------
                     Rabbit  ------caaaat----------------------------tacaa-------------------------
                       Pika  ------ccaaat----------------------------gacaa-------------------------
                        Pig  ------caaaat----------------------------cacaa-------------------------
                     Alpaca  ------caaaat----------------------------tacaa-------------------------
             Bactrian camel  ------caaaat----------------------------tacaa-------------------------
                    Dolphin  ------caaaat----------------------------tacaa-------------------------
               Killer whale  ------caaaat----------------------------tacaa-------------------------
           Tibetan antelope  ------caaaat----------------------------tacaa-------------------------
                        Cow  ------caaaat----------------------------tacaa-------------------------
                      Sheep  ------caaaat----------------------------tacaa-------------------------
              Domestic goat  ------caaaat----------------------------tacaa-------------------------
                      Horse  ------caaaat----------------------------cacaa-------------------------
           White rhinoceros  ------caaaat----------------------------cacaa-------------------------
                        Cat  ------caaaat----------------------------tacaa-------------------------
                        Dog  ------caaaat----------------------------tacaa-------------------------
                    Ferret   ------gaaaat----------------------------tacaa-------------------------
                      Panda  ------gaaaat----------------------------tacaa-------------------------
             Pacific walrus  ------gaaaat----------------------------tacga-------------------------
               Weddell seal  ------gaaaat----------------------------tacaa-------------------------
           Black flying-fox  ------caaaat----------------------------tgcaa-------------------------
                    Megabat  ------caaaat----------------------------tgcaa-------------------------
              Big brown bat  ------caatgc----------------------------cgc---------------------------
       David's myotis (bat)  ------cagtgc----------------------------cgc---------------------------
                   Hedgehog  ------cagact----------------------------tgcaa-------------------------
                      Shrew  ------caaaat----------------------------gataa-------------------------
            Star-nosed mole  ------caaaat----------------------------gcaaa-------------------------
                   Elephant  ------cgaaat----------------------------tacaa-------------------------
                    Manatee  ------ccaaat----------------------------tacaa-------------------------
           Cape golden mole  ----------------------------------------------------------------------
                     Tenrec  ------caaaac----------------------------gacaa-------------------------
                   Aardvark  ------caaaat----------------------------tagaa-------------------------
                  Armadillo  ------caaaat----------------------------tacaa-------------------------
             Golden hamster  ======================================================================
        Cape elephant shrew  ======================================================================
                Rock pigeon  ======================================================================
            Tasmanian devil  ======================================================================
                    Opossum  ======================================================================
                   Bushbaby  ======================================================================

                      Human  ----------------------------------------at-atg--ta--ta
                      Chimp  ----------------------------------------at-atg--ta--ta
                    Gorilla  ----------------------------------------at-atg--ta--ta
                  Orangutan  ----------------------------------------at-atg--ta--ta
                     Gibbon  ----------------------------------------at-acg--ta--ta
                     Rhesus  ----------------------------------------at-atg--ta--ta
        Crab-eating macaque  ----------------------------------------at-atg--ta--ta
                     Baboon  ----------------------------------------at-atg--ta--ta
               Green monkey  ----------------------------------------at-atg--ta--ta
                   Marmoset  ----------------------------------------tt-atg--ta--ta
            Squirrel monkey  ----------------------------------------tt-ttg--ca--ta
         Chinese tree shrew  ----------------------------------------ac-atg--ga--ca
                   Squirrel  ----------------------------------------at-aaa--ta----
     Lesser Egyptian jerboa  ----------------------------------------at-gtg--ta----
               Prairie vole  ----------------------------------------at-gta--ta----
            Chinese hamster  tataggttcaaacataaccattatggggcaggatgtgcagat-gag--tg----
                      Mouse  ----------------------------------------at-ata--ta----
                        Rat  ----------------------------------------at-atg--ta----
             Naked mole-rat  ----------------------------------------gt-agg--caca--
                 Guinea pig  ----------------------------------------at-aaa--caca--
                 Chinchilla  ----------------------------------------at-acg--caca--
           Brush-tailed rat  ----------------------------------------at-atg--caca--
                     Rabbit  ----------------------------------------ac-atgcaca----
                       Pika  ----------------------------------------ac-agg--ca----
                        Pig  ----------------------------------------at-atg--tg--ta
                     Alpaca  ----------------------------------------at-a----ta--ta
             Bactrian camel  ----------------------------------------at-a----ta--ta
                    Dolphin  ----------------------------------------at-atg--ta--ta
               Killer whale  ----------------------------------------at-atg--ta--ta
           Tibetan antelope  ----------------------------------------at-atg--ta--ta
                        Cow  ----------------------------------------at-atg--ta--ta
                      Sheep  ----------------------------------------at-atg--ta--ta
              Domestic goat  ----------------------------------------at-atg--ta--ta
                      Horse  -------------------------------------------acg--ta--ca
           White rhinoceros  ----------------------------------------at-atg--tt--ca
                        Cat  ----------------------------------------at-atg--tg--ca
                        Dog  ----------------------------------------at-atg--tg--ca
                    Ferret   ----------------------------------------at-atg--tg--ca
                      Panda  ----------------------------------------ataatg--tg--ca
             Pacific walrus  ----------------------------------------at-atg--tg--ca
               Weddell seal  ----------------------------------------at-atg--tg--ca
           Black flying-fox  ----------------------------------------at-aag--ta--ca
                    Megabat  ----------------------------------------at-aag--ta--ca
              Big brown bat  --------------------------------------------ag--cg--gg
       David's myotis (bat)  --------------------------------------------ag--ca--gg
                   Hedgehog  -------------------------------------------atg--ta--ga
                      Shrew  ------------------------------------------------ta--gg
            Star-nosed mole  -----------------------------------------t-atg--ta--ga
                   Elephant  ----------------------------------------at-agg--ta--cc
                    Manatee  ----------------------------------------ac-aga--ga--cc
           Cape golden mole  -------------------------------------------agg--ta--ta
                     Tenrec  ----------------------------------------gc-agg--ta--ca
                   Aardvark  ----------------------------------------ac-agg--ta--ca
                  Armadillo  ----------------------------------------at-aca--ta--ta
             Golden hamster  ======================================================
        Cape elephant shrew  ======================================================
                Rock pigeon  ======================================================
            Tasmanian devil  ======================================================
                    Opossum  ======================================================
                   Bushbaby  ======================================================

Inserts between block 21 and 22 in window
B D               Squirrel 5bp
    Lesser Egyptian jerboa 2bp
B D                  Mouse 292bp
B D                    Rat 2bp
B D                 Tenrec 5bp

Alignment block 22 of 713 in window, 31658364 - 31658364, 1 bps 
B D                   Human  c
B D                   Chimp  c
B D                 Gorilla  c
B D               Orangutan  c
B D                  Gibbon  c
B D                  Rhesus  c
B D     Crab-eating macaque  c
B D                  Baboon  c
B D            Green monkey  c
B D                Marmoset  c
B D         Squirrel monkey  c
         Chinese tree shrew  c
B D                Squirrel  t
     Lesser Egyptian jerboa  c
               Prairie vole  c
B D         Chinese hamster  c
B D                     Rat  c
B D          Naked mole-rat  c
B D              Guinea pig  c
                 Chinchilla  c
           Brush-tailed rat  c
B D                  Rabbit  c
B D                    Pika  c
B D                     Pig  c
B D                  Alpaca  c
             Bactrian camel  c
B D                 Dolphin  c
               Killer whale  c
           Tibetan antelope  c
B D                     Cow  c
B D                   Sheep  c
              Domestic goat  c
B D                   Horse  c
B D        White rhinoceros  c
B D                     Cat  c
B D                     Dog  c
B D                 Ferret   c
B D                   Panda  c
             Pacific walrus  c
               Weddell seal  c
           Black flying-fox  c
B D                 Megabat  c
              Big brown bat  c
       David's myotis (bat)  c
B D                Hedgehog  c
B D                   Shrew  c
            Star-nosed mole  t
B D                Elephant  c
B D                 Manatee  g
           Cape golden mole  c
B D                  Tenrec  t
                   Aardvark  c
B D               Armadillo  a
            Golden hamster  =
       Cape elephant shrew  =
B D                   Mouse  =
  D             Rock pigeon  =
B D         Tasmanian devil  =
B D                 Opossum  =
B D                Bushbaby  =

Inserts between block 22 and 23 in window
              Prairie vole 4479bp
B D        Chinese hamster 1bp

Alignment block 23 of 713 in window, 31658365 - 31658370, 6 bps 
B D                   Human  t--tc--cta
B D                   Chimp  t--tc--cta
B D                 Gorilla  t--tc--cta
B D               Orangutan  t--tc--cta
B D                  Gibbon  t--tc--cta
B D                  Rhesus  t--tc--cta
B D     Crab-eating macaque  t--tc--cta
B D                  Baboon  t--tc--cta
B D            Green monkey  t--tt--cta
B D                Marmoset  t--tt--ctg
B D         Squirrel monkey  t--tc--ctg
         Chinese tree shrew  t--ct--cta
B D                Squirrel  t--tc--cca
     Lesser Egyptian jerboa  --------ta
B D         Chinese hamster  ----t--cca
B D                     Rat  c--tt--tta
B D          Naked mole-rat  t--tc--tta
B D              Guinea pig  t--tc--tta
                 Chinchilla  t--tc--tta
           Brush-tailed rat  t--tc--agg
B D                  Rabbit  t--tt--cta
B D                    Pika  c--tc--gca
B D                     Pig  t--tt--cta
B D                  Alpaca  t--tt--cta
             Bactrian camel  t--tt--cta
B D                 Dolphin  t--tt--caa
               Killer whale  t--tt--caa
           Tibetan antelope  t--tt--caa
B D                     Cow  t--tt--caa
B D                   Sheep  t--tt--caa
              Domestic goat  t--tt--caa
B D                   Horse  t--tt--tca
B D        White rhinoceros  t--tt--cta
B D                     Cat  t--tt--cga
B D                     Dog  t--tt--cta
B D                 Ferret   t--tt--cta
B D                   Panda  t--tt--cta
             Pacific walrus  t--tt--cta
               Weddell seal  t--tt--cta
           Black flying-fox  t--tt--ctg
B D                 Megabat  t--tt--ctg
              Big brown bat  g--ct--cct
       David's myotis (bat)  g--cgcacct
B D                Hedgehog  ctttt--cta
B D                   Shrew  c--ca--cta
            Star-nosed mole  t--tt--cta
B D                Elephant  t--tt--cta
B D                 Manatee  t--tt--cta
           Cape golden mole  t--tt--cta
B D                  Tenrec  g--tc--cta
                   Aardvark  t--tt--cta
B D               Armadillo  t--tc--t-a
            Golden hamster  ==========
              Prairie vole  ==========
       Cape elephant shrew  ==========
B D                   Mouse  ==========
  D             Rock pigeon  ==========
B D         Tasmanian devil  ==========
B D                 Opossum  ==========
B D                Bushbaby  ==========

Inserts between block 23 and 24 in window
    Lesser Egyptian jerboa 4bp
B D        Chinese hamster 2bp
B D                    Rat 111bp

Alignment block 24 of 713 in window, 31658371 - 31658372, 2 bps 
B D                   Human  g------a
B D                   Chimp  g------a
B D                 Gorilla  g------a
B D               Orangutan  g------a
B D                  Gibbon  g------a
B D                  Rhesus  g------a
B D     Crab-eating macaque  g------a
B D                  Baboon  g------a
B D            Green monkey  g------a
B D                Marmoset  g------a
B D         Squirrel monkey  g------a
         Chinese tree shrew  g------a
B D                Squirrel  g------a
     Lesser Egyptian jerboa  g------a
B D         Chinese hamster  g------a
B D          Naked mole-rat  g------a
B D              Guinea pig  g------a
                 Chinchilla  g------a
           Brush-tailed rat  gctggcca
B D                  Rabbit  g------a
B D                    Pika  g------c
B D                     Pig  g------a
B D                  Alpaca  g------a
             Bactrian camel  g------a
B D                 Dolphin  g------a
               Killer whale  g------a
           Tibetan antelope  g------a
B D                     Cow  g------a
B D                   Sheep  g------a
              Domestic goat  g------a
B D                   Horse  g------a
B D        White rhinoceros  g------a
B D                     Cat  g------a
B D                     Dog  g------a
B D                 Ferret   g------a
B D                   Panda  g------a
             Pacific walrus  g------a
               Weddell seal  g------a
           Black flying-fox  g------a
B D                 Megabat  g------a
              Big brown bat  g------g
       David's myotis (bat)  g------g
B D                Hedgehog  g------a
B D                   Shrew  g-----ta
            Star-nosed mole  g------a
B D                Elephant  g------a
B D                 Manatee  g------a
           Cape golden mole  g------a
B D                  Tenrec  g------a
                   Aardvark  g------a
B D               Armadillo  g------a
            Golden hamster  ========
              Prairie vole  ========
B D                     Rat  ========
       Cape elephant shrew  ========
B D                   Mouse  ========
  D             Rock pigeon  ========
B D         Tasmanian devil  ========
B D                 Opossum  ========
B D                Bushbaby  ========

Inserts between block 24 and 25 in window
B D               Squirrel 677bp
B D                    Dog 1bp

Alignment block 25 of 713 in window, 31658373 - 31658375, 3 bps 
B D                   Human  gga
B D                   Chimp  gga
B D                 Gorilla  gga
B D               Orangutan  gga
B D                  Gibbon  gga
B D                  Rhesus  gga
B D     Crab-eating macaque  gga
B D                  Baboon  gaa
B D            Green monkey  gga
B D                Marmoset  gga
B D         Squirrel monkey  aga
         Chinese tree shrew  aga
     Lesser Egyptian jerboa  aaa
B D         Chinese hamster  gaa
B D          Naked mole-rat  gga
B D              Guinea pig  gga
                 Chinchilla  gga
           Brush-tailed rat  gat
B D                  Rabbit  gga
B D                    Pika  aga
B D                     Pig  gga
B D                  Alpaca  gga
             Bactrian camel  gga
B D                 Dolphin  gga
               Killer whale  gga
           Tibetan antelope  gga
B D                     Cow  gga
B D                   Sheep  gga
              Domestic goat  gga
B D                   Horse  gga
B D        White rhinoceros  gga
B D                     Cat  gga
B D                     Dog  aga
B D                 Ferret   ggc
B D                   Panda  ggc
             Pacific walrus  ggc
               Weddell seal  ggc
           Black flying-fox  gga
B D                 Megabat  gga
              Big brown bat  ggg
       David's myotis (bat)  ggg
B D                Hedgehog  agg
B D                   Shrew  aga
            Star-nosed mole  gga
B D                Elephant  gga
        Cape elephant shrew  aaa
B D                 Manatee  gga
           Cape golden mole  agg
B D                  Tenrec  gga
                   Aardvark  agc
B D               Armadillo  gga
            Golden hamster  ===
              Prairie vole  ===
B D                     Rat  ===
B D                   Mouse  ===
  D             Rock pigeon  ===
B D         Tasmanian devil  ===
B D                 Opossum  ===
B D                Squirrel  ===
B D                Bushbaby  ===

Inserts between block 25 and 26 in window
    Lesser Egyptian jerboa 413bp

Alignment block 26 of 713 in window, 31658376 - 31658377, 2 bps 
B D                   Human  tg
B D                   Chimp  tg
B D                 Gorilla  tg
B D               Orangutan  tg
B D                  Gibbon  gg
B D                  Rhesus  tg
B D     Crab-eating macaque  tg
B D                  Baboon  tg
B D            Green monkey  tg
B D                Marmoset  tg
B D         Squirrel monkey  tg
         Chinese tree shrew  tg
B D         Chinese hamster  tg
B D          Naked mole-rat  tg
B D              Guinea pig  ag
                 Chinchilla  ag
           Brush-tailed rat  ag
B D                  Rabbit  tg
B D                    Pika  tg
B D                     Pig  ca
B D                  Alpaca  tg
             Bactrian camel  tg
B D                 Dolphin  tg
               Killer whale  tg
           Tibetan antelope  tg
B D                     Cow  tg
B D                   Sheep  tg
              Domestic goat  tg
B D                   Horse  tg
B D        White rhinoceros  tg
B D                     Cat  tg
B D                     Dog  tg
B D                 Ferret   tg
B D                   Panda  tg
             Pacific walrus  tg
               Weddell seal  tg
           Black flying-fox  cg
B D                 Megabat  cg
              Big brown bat  tg
       David's myotis (bat)  tg
B D                Hedgehog  tg
B D                   Shrew  tg
            Star-nosed mole  tg
B D                Elephant  ta
        Cape elephant shrew  ga
B D                 Manatee  ta
           Cape golden mole  ca
B D                  Tenrec  ta
                   Aardvark  ta
B D               Armadillo  tg
            Golden hamster  ==
              Prairie vole  ==
B D                     Rat  ==
B D                   Mouse  ==
    Lesser Egyptian jerboa  ==
  D             Rock pigeon  ==
B D         Tasmanian devil  ==
B D                 Opossum  ==
B D                Squirrel  ==
B D                Bushbaby  ==

Inserts between block 26 and 27 in window
B D        Chinese hamster 347bp

Alignment block 27 of 713 in window, 31658378 - 31658380, 3 bps 
B D                   Human  at-a----
B D                   Chimp  at-a----
B D                 Gorilla  at-a----
B D               Orangutan  at-a----
B D                  Gibbon  at------
B D                  Rhesus  ataa----
B D     Crab-eating macaque  at-a----
B D                  Baboon  at-a----
B D            Green monkey  at-t----
B D                Marmoset  at-c----
B D         Squirrel monkey  at-c----
         Chinese tree shrew  atta----
B D              Guinea pig  -t------
                 Chinchilla  -t------
           Brush-tailed rat  -c------
B D                  Rabbit  ac------
B D                    Pika  at------
B D                     Pig  ---a----
B D                  Alpaca  ---a----
             Bactrian camel  ---a----
B D                 Dolphin  ---a----
               Killer whale  ---a----
           Tibetan antelope  ---a----
B D                     Cow  ---a----
B D                   Sheep  ---a----
              Domestic goat  ---a----
B D                   Horse  ---a----
B D        White rhinoceros  ---a----
B D                     Cat  ---a----
B D                     Dog  ---a----
B D                 Ferret   ---a----
B D                   Panda  ---a----
             Pacific walrus  ---a----
               Weddell seal  ---a----
           Black flying-fox  ---c----
B D                 Megabat  ---c----
              Big brown bat  ---a----
       David's myotis (bat)  ---g----
B D                Hedgehog  ---c----
B D                   Shrew  ---g----
            Star-nosed mole  ---a----
B D                Elephant  ---a--tg
        Cape elephant shrew  ---g--tg
B D                 Manatee  ---g--cg
           Cape golden mole  ---a--ta
B D                  Tenrec  ---a--ta
                   Aardvark  ---a--ta
B D               Armadillo  ---atttt
            Golden hamster  ========
              Prairie vole  ========
B D         Chinese hamster  ========
B D                     Rat  ========
B D          Naked mole-rat  --------
B D                   Mouse  ========
    Lesser Egyptian jerboa  ========
  D             Rock pigeon  ========
B D         Tasmanian devil  ========
B D                 Opossum  ========
B D                Squirrel  ========
B D                Bushbaby  ========

Inserts between block 27 and 28 in window
B D                    Pig 1bp
B D                 Alpaca 4bp
            Bactrian camel 4bp
B D                Dolphin 2bp
              Killer whale 2bp
          Tibetan antelope 3bp
B D                    Cow 3bp
B D                  Sheep 5bp
             Domestic goat 3bp
B D                  Horse 1bp
B D       White rhinoceros 1bp
B D                    Cat 1bp
B D                    Dog 9bp
B D                Ferret  2bp
B D                  Panda 2bp
            Pacific walrus 1bp
              Weddell seal 1bp
          Black flying-fox 1bp
B D                Megabat 2bp
             Big brown bat 1bp
      David's myotis (bat) 1bp
B D               Hedgehog 1bp
B D                  Shrew 1bp
           Star-nosed mole 1bp

Alignment block 28 of 713 in window, 31658381 - 31658392, 12 bps 
B D                   Human  aaa-a----aatgtgaa-------
B D                   Chimp  aaa-a----aatgtgaa-------
B D                 Gorilla  aaa-a----aatgtgaa-------
B D               Orangutan  aaa-a----aatgtgaa-------
B D                  Gibbon  aaa-a----aatgtgaa-------
B D                  Rhesus  aaa-a----aatgtgaa-------
B D     Crab-eating macaque  aaa-a----aatgtgaa-------
B D                  Baboon  aaa-a----aatgtgaa-------
B D            Green monkey  aaa-a----aatgtgaa-------
B D                Marmoset  aaa-a----aatgtgaa-------
B D         Squirrel monkey  aaa-a----aatgtgaa-------
         Chinese tree shrew  aaa-a----aatgtgag-------
B D                   Mouse  aga-a----aatgtgaa-------
B D                     Rat  aaa-a----aatgtgaa-------
B D          Naked mole-rat  ata-t----aatgtgag-------
B D              Guinea pig  aca-t----aatgtgat-------
                 Chinchilla  aca-t----aatgtgaa-------
           Brush-tailed rat  tcagt----gggttgaa-------
B D                  Rabbit  aaa-a----tatgcgaa-------
B D                    Pika  gaa-a----cacccgca-------
B D                     Pig  aaa-a----aatggaga-------
B D                  Alpaca  gaa-a----aatgtaga-------
             Bactrian camel  gaa-a----aatgtaga-------
B D                 Dolphin  aaa-a----aatgtgga-------
               Killer whale  aaa-a----aatgtgga-------
           Tibetan antelope  aaa-a----aaagtgaa-------
B D                     Cow  aaa-a----aaagtgaa-------
B D                   Sheep  aaa-a----aaagtgaa-------
              Domestic goat  aaa-a----aaagtgaa-------
B D                   Horse  aaa-a---caatgtgga-------
B D        White rhinoceros  aaa-a----aatgtgga-------
B D                     Cat  aaa-a----aatgtgga-------
B D                     Dog  caa-a----aacgtgga-------
B D                 Ferret   gaa-a----aatgtgga-------
B D                   Panda  aaa-a----aatgtgga-------
             Pacific walrus  aaa-a----aatgtgga-------
               Weddell seal  aaa-a----aatgtgga-------
           Black flying-fox  aaa-a----aatgtaga-------
B D                 Megabat  aaa-a----aatgtaga-------
              Big brown bat  agc-g----cgtgtggg-------
       David's myotis (bat)  gcc-a----ggtgtggg-------
B D                Hedgehog  aga-aaaatgaggctt--------
B D                   Shrew  aaa-a----catgcata-------
            Star-nosed mole  aga-a----gatgtct--------
B D                Elephant  -ga-a----tatggagaatgtgga
        Cape elephant shrew  -ga-a---------aaaatac---
B D                 Manatee  -ga-a----tatttagaacgtgga
           Cape golden mole  -aa-a----tatgtagaacgtgga
B D                  Tenrec  -aa-a----tatgtggaacatggg
                   Aardvark  -ta-a----tatatagaat-tgga
B D               Armadillo  -aa-a----aatgtggaaagtggg
            Golden hamster  ========================
              Prairie vole  ========================
B D         Chinese hamster  ========================
    Lesser Egyptian jerboa  ========================
  D             Rock pigeon  ========================
B D         Tasmanian devil  ========================
B D                 Opossum  ========================
B D                Squirrel  ========================
B D                Bushbaby  ========================

Inserts between block 28 and 29 in window
B D              Armadillo 4bp

Alignment block 29 of 713 in window, 31658393 - 31658396, 4 bps 
B D                   Human  ttgt
B D                   Chimp  ttgt
B D                 Gorilla  ttgt
B D               Orangutan  ttgt
B D                  Gibbon  ttgt
B D                  Rhesus  ttgt
B D     Crab-eating macaque  ttgt
B D                  Baboon  ttgt
B D            Green monkey  ttgt
B D                Marmoset  ttgt
B D         Squirrel monkey  ttgt
         Chinese tree shrew  ttgt
     Lesser Egyptian jerboa  ttgt
B D                   Mouse  ctgt
B D                     Rat  ctgt
B D          Naked mole-rat  gtgc
B D              Guinea pig  tttt
                 Chinchilla  ttgc
           Brush-tailed rat  gtgc
B D                  Rabbit  tcgt
B D                    Pika  tcgt
B D                     Pig  ttgt
B D                  Alpaca  ttgt
             Bactrian camel  ttgt
B D                 Dolphin  ttgt
               Killer whale  ttgt
           Tibetan antelope  ctgt
B D                     Cow  ctgt
B D                   Sheep  ctgt
              Domestic goat  ctgt
B D                   Horse  ttgt
B D        White rhinoceros  ttga
B D                     Cat  ttgt
B D                     Dog  ttgt
B D                 Ferret   ttgt
B D                   Panda  ttgt
             Pacific walrus  ttgt
               Weddell seal  ttgt
           Black flying-fox  ttgt
B D                 Megabat  ttgt
              Big brown bat  gtgt
       David's myotis (bat)  --ct
B D                   Shrew  ctaa
B D                Elephant  tt--
        Cape elephant shrew  tt--
B D                 Manatee  tc--
                   Aardvark  tc--
B D                Hedgehog  ----
            Golden hamster  ====
           Star-nosed mole  ----
B D                  Tenrec  ----
              Prairie vole  ====
B D         Chinese hamster  ====
B D               Armadillo  ====
          Cape golden mole  ----
  D             Rock pigeon  ====
B D         Tasmanian devil  ====
B D                 Opossum  ====
B D                Squirrel  ====
B D                Bushbaby  ====

Inserts between block 29 and 30 in window
        Chinese tree shrew 991bp
B D               Elephant 190bp
       Cape elephant shrew 10bp
B D                Manatee 20bp
                  Aardvark 20bp

Alignment block 30 of 713 in window, 31658397 - 31658399, 3 bps 
B D                   Human  a-tt
B D                   Chimp  g-tt
B D                 Gorilla  g-tt
B D               Orangutan  g-tt
B D                  Gibbon  g-tt
B D                  Rhesus  gttt
B D     Crab-eating macaque  gttt
B D                  Baboon  gttt
B D            Green monkey  gttt
B D                Marmoset  g-tt
B D         Squirrel monkey  g-tt
     Lesser Egyptian jerboa  --at
B D                   Mouse  --gt
B D                     Rat  --gt
B D          Naked mole-rat  --tt
B D              Guinea pig  --ct
                 Chinchilla  --tt
           Brush-tailed rat  --tg
B D                  Rabbit  --gt
B D                    Pika  --gt
B D                     Pig  --tt
B D                  Alpaca  --gt
             Bactrian camel  --gt
B D                 Dolphin  --gt
               Killer whale  --gt
           Tibetan antelope  --gt
B D                     Cow  --gt
B D                   Sheep  --gt
              Domestic goat  --gt
B D                   Horse  --gt
B D        White rhinoceros  --gt
B D                     Cat  --gc
B D                     Dog  --gc
B D                 Ferret   --gt
B D                   Panda  --gt
             Pacific walrus  --gt
               Weddell seal  --gt
           Black flying-fox  --gt
B D                 Megabat  --gt
              Big brown bat  --gt
       David's myotis (bat)  --gt
B D                Hedgehog  --gt
B D                   Shrew  --gt
            Golden hamster  ====
           Star-nosed mole  ----
B D                  Tenrec  ----
              Prairie vole  ====
B D         Chinese hamster  ====
B D               Armadillo  ====
       Cape elephant shrew  ====
                  Aardvark  ====
          Cape golden mole  ----
  D             Rock pigeon  ====
B D         Tasmanian devil  ====
B D                 Opossum  ====
B D                 Manatee  ====
B D                Elephant  ====
B D                Squirrel  ====
        Chinese tree shrew  ====
B D                Bushbaby  ====

Inserts between block 30 and 31 in window
    Lesser Egyptian jerboa 1bp
B D                  Mouse 1bp
B D                    Rat 1bp
B D         Naked mole-rat 1bp
B D             Guinea pig 131bp
                Chinchilla 9bp
          Brush-tailed rat 125bp
B D                 Rabbit 1bp
B D                   Pika 1bp
B D                    Pig 1bp
B D                 Alpaca 1bp
            Bactrian camel 1bp
B D                Dolphin 1bp
              Killer whale 1bp
          Tibetan antelope 1bp
B D                    Cow 1bp
B D                  Sheep 1bp
             Domestic goat 1bp
B D                  Horse 1bp
B D       White rhinoceros 1bp
B D                    Cat 1bp
B D                    Dog 1bp
B D                Ferret  1bp
B D                  Panda 1bp
            Pacific walrus 1bp
              Weddell seal 1bp
          Black flying-fox 1bp
B D                Megabat 1bp
             Big brown bat 1bp
      David's myotis (bat) 1bp
B D               Hedgehog 1bp
B D                  Shrew 1bp

Alignment block 31 of 713 in window, 31658400 - 31658421, 22 bps 
B D                   Human  tctctga-----------ta--------------------------------------------------
B D                   Chimp  tctctga-----------ta--------------------------------------------------
B D                 Gorilla  tctctga-----------ta--------------------------------------------------
B D               Orangutan  tctctga-----------ca--------------------------------------------------
B D                  Gibbon  tctctga-----------ta--------------------------------------------------
B D                  Rhesus  tctctga-----------ta--------------------------------------------------
B D     Crab-eating macaque  tctctga-----------ta--------------------------------------------------
B D                  Baboon  tctctga-----------ta--------------------------------------------------
B D            Green monkey  tctctga-----------ga--------------------------------------------------
B D                Marmoset  tctctga-----------ta--------------------------------------------------
B D         Squirrel monkey  tctctga-----------ta--------------------------------------------------
     Lesser Egyptian jerboa  gctctca-----------ta--------------------------------------------------
B D                   Mouse  tctctca-----------ca--------------------------------------------------
B D                     Rat  tctctca-----------ca--------------------------------------------------
B D          Naked mole-rat  tctctga-----------ca--------------------------------------------------
B D              Guinea pig  tttctaa-----------ta--------------------------------------------------
                 Chinchilla  gtattag-----------cc--------------------------------------------------
           Brush-tailed rat  gtactaa-----------gcctattatgtaaacaaacaaataaatatgcacacttcttaatggcagcatg
B D                  Rabbit  tctctag-----------tg--------------------------------------------------
B D                    Pika  actctgg-----------tg--------------------------------------------------
B D                     Pig  tttctga-----------ca--------------------------------------------------
B D                  Alpaca  cctctga-----------ca--------------------------------------------------
             Bactrian camel  cctctga-----------ca--------------------------------------------------
B D                 Dolphin  tctctga-----------ca--------------------------------------------------
               Killer whale  tctctga-----------ca--------------------------------------------------
           Tibetan antelope  tctgtga-----------ca--------------------------------------------------
B D                     Cow  cctgtga-----------ta--------------------------------------------------
B D                   Sheep  tctgtga-----------ca--------------------------------------------------
              Domestic goat  tctgtga-----------ca--------------------------------------------------
B D                   Horse  tctctga-----------ca--------------------------------------------------
B D        White rhinoceros  tctctga-----------ca--------------------------------------------------
B D                     Cat  tctctgg-----------ta--------------------------------------------------
B D                     Dog  tctttga-----------tt--------------------------------------------------
B D                 Ferret   tctctgacgccttagaatca--------------------------------------------------
B D                   Panda  tctttga-----------ta--------------------------------------------------
             Pacific walrus  tctttga-----------ta--------------------------------------------------
               Weddell seal  tgtttga-----------ta--------------------------------------------------
           Black flying-fox  tctctga-----------ca--------------------------------------------------
B D                 Megabat  tctctga-----------ca--------------------------------------------------
              Big brown bat  tccccga-----------cc--------------------------------------------------
       David's myotis (bat)  tccctga-----------cg--------------------------------------------------
B D                Hedgehog  tctctga-----------ca--------------------------------------------------
B D                   Shrew  ttcctaa-----------aa--------------------------------------------------
            Star-nosed mole  ctcccag-----------ga--------------------------------------------------
B D                Elephant  tctctga-----------ta--------------------------------------------------
        Cape elephant shrew  ttattgt-----------ta--------------------------------------------------
B D                 Manatee  cctatga-----------ca--------------------------------------------------
           Cape golden mole  --tctga-----------aa--------------------------------------------------
B D                  Tenrec  tctctgg-----------ta--------------------------------------------------
                   Aardvark  tctctga-----------ta--------------------------------------------------
B D               Armadillo  actctga-----------tg--------------------------------------------------
            Golden hamster  ======================================================================
              Prairie vole  ======================================================================
B D         Chinese hamster  ======================================================================
  D             Rock pigeon  ======================================================================
B D         Tasmanian devil  ======================================================================
B D                 Opossum  ======================================================================
B D                Squirrel  ======================================================================
        Chinese tree shrew  ======================================================================
B D                Bushbaby  ======================================================================

                      Human  ---------------------------gaggatgc-----------------attag
                      Chimp  ---------------------------gaggatgc-----------------attag
                    Gorilla  ---------------------------caggatgc-----------------atcag
                  Orangutan  ---------------------------gaggatgc-----------------attag
                     Gibbon  ---------------------------gaggatgc-----------------attag
                     Rhesus  ---------------------------gaggatgc-----------------attag
        Crab-eating macaque  ---------------------------gaggatgc-----------------attag
                     Baboon  ---------------------------gaggatgc-----------------attag
               Green monkey  ---------------------------gaggatgc-----------------attag
                   Marmoset  ---------------------------ggggatgc-----------------attag
            Squirrel monkey  ---------------------------gaggatgc-----------------attag
     Lesser Egyptian jerboa  ---------------------------gaagatgc-----------------atcag
                      Mouse  ---------------------------gaagatga-----------------atcag
                        Rat  ---------------------------gaagacac-----------------acctg
             Naked mole-rat  ---------------------------gaaaatgg-----------------attag
                 Guinea pig  ---------------------------caggatac-----------------attag
                 Chinchilla  ---------------------------------------------------------
           Brush-tailed rat  ttatgtgaacataacagggtgcttacctctgatgc-----------------attag
                     Rabbit  ---------------------------ga---------------------------g
                       Pika  ---------------------------caggatat-----------------gtttg
                        Pig  ---------------------------ga--atgt-----------------ctttg
                     Alpaca  ---------------------------gaaggtga-----------------cttag
             Bactrian camel  ---------------------------gaagatga-----------------cttag
                    Dolphin  ---------------------------gaagatgc-----------------ctttg
               Killer whale  ---------------------------gaagatgc-----------------ctttg
           Tibetan antelope  ---------------------------gatga-g------------------atctg
                        Cow  ---------------------------gatgacg------------------gtatg
                      Sheep  ---------------------------gatgacg------------------atttg
              Domestic goat  ---------------------------gatgatg------------------atttg
                      Horse  ---------------------------gaggatga-----------------ctcag
           White rhinoceros  ---------------------------gaggatgc-----------------cttag
                        Cat  ---------------------------gaggaagc-----------------cttgg
                        Dog  ---------------------------gaggacgg-----------------cttag
                    Ferret   ---------------------------gaggacgc-----------------cttag
                      Panda  ---------------------------gagaacac-----------------cttag
             Pacific walrus  ---------------------------gaggacgc-----------------cttaa
               Weddell seal  ---------------------------gaggacgc-----------------cttag
           Black flying-fox  ---------------------------gaggatgc-----------------cttag
                    Megabat  ---------------------------gaggatgc-----------------cttag
              Big brown bat  ---------------------------gagaacgc-----------------gttag
       David's myotis (bat)  ---------------------------gagaacgc-----------------cttag
                   Hedgehog  ---------------------------ggagaagc-----------------ctcag
                      Shrew  ---------------------------ggaaagaa-----------------cttag
            Star-nosed mole  ---------------------------tgca--------------------------
                   Elephant  ---------------------------gaggatgc-----------------gttat
        Cape elephant shrew  ---------------------------aaaaatgtagatctaaaacatacagattat
                    Manatee  ---------------------------gagaatgc-----------------attat
           Cape golden mole  ---------------------------tatgtgga-----------------attgt
                     Tenrec  ---------------------------gaggagac-----------------gttgt
                   Aardvark  ---------------------------gaggatgc-----------------attgt
                  Armadillo  ---------------------------gagaatgc-----------------attag
             Golden hamster  =========================================================
               Prairie vole  =========================================================
            Chinese hamster  =========================================================
                Rock pigeon  =========================================================
            Tasmanian devil  =========================================================
                    Opossum  =========================================================
                   Squirrel  =========================================================
         Chinese tree shrew  =========================================================
                   Bushbaby  =========================================================

Inserts between block 31 and 32 in window
    Lesser Egyptian jerboa 1bp
B D                  Mouse 2276bp
      David's myotis (bat) 4bp

Alignment block 32 of 713 in window, 31658422 - 31658425, 4 bps 
B D                   Human  agt-c
B D                   Chimp  agt-c
B D                 Gorilla  agt-c
B D               Orangutan  agt-c
B D                  Gibbon  agt-c
B D                  Rhesus  agt-c
B D     Crab-eating macaque  agt-c
B D                  Baboon  agt-c
B D            Green monkey  agt-c
B D                Marmoset  agt-c
B D         Squirrel monkey  agt-c
     Lesser Egyptian jerboa  ggc--
B D                     Rat  ggc--
B D          Naked mole-rat  agt--
B D              Guinea pig  aat--
                 Chinchilla  --t--
           Brush-tailed rat  aat--
B D                  Rabbit  agtc-
B D                    Pika  ggtt-
B D                     Pig  agt-c
B D                  Alpaca  aga-c
             Bactrian camel  aga-c
B D                 Dolphin  agt-c
               Killer whale  agt-c
           Tibetan antelope  agc-c
B D                     Cow  agc-c
B D                   Sheep  agc-c
              Domestic goat  agc-c
B D                   Horse  agt-a
B D        White rhinoceros  agt-a
B D                     Cat  agt-c
B D                     Dog  agt-c
B D                 Ferret   aat-c
B D                   Panda  aat-c
             Pacific walrus  aat-c
               Weddell seal  aat-c
           Black flying-fox  agt-c
B D                 Megabat  agt-c
              Big brown bat  agt-c
       David's myotis (bat)  agt-c
B D                Hedgehog  agcac
B D                   Shrew  att-c
B D                Elephant  ggt-c
        Cape elephant shrew  aga-t
B D                 Manatee  agt-c
           Cape golden mole  agt-c
B D                  Tenrec  agt-a
                   Aardvark  agt-c
B D               Armadillo  agg-t
            Golden hamster  =====
           Star-nosed mole  -----
              Prairie vole  =====
B D         Chinese hamster  =====
B D                   Mouse  =====
  D             Rock pigeon  =====
B D         Tasmanian devil  =====
B D                 Opossum  =====
B D                Squirrel  =====
        Chinese tree shrew  =====
B D                Bushbaby  =====

Inserts between block 32 and 33 in window
    Lesser Egyptian jerboa 210bp
B D                    Rat 559bp
B D         Naked mole-rat 3bp
B D             Guinea pig 3bp
                Chinchilla 3bp
          Brush-tailed rat 3bp

Alignment block 33 of 713 in window, 31658426 - 31658427, 2 bps 
B D                   Human  tg
B D                   Chimp  tg
B D                 Gorilla  tg
B D               Orangutan  tg
B D                  Gibbon  tg
B D                  Rhesus  tg
B D     Crab-eating macaque  tg
B D                  Baboon  tg
B D            Green monkey  tg
B D                Marmoset  tg
B D         Squirrel monkey  tg
B D                  Rabbit  ca
B D                    Pika  ca
B D                     Pig  ca
B D                  Alpaca  ca
             Bactrian camel  ca
B D                 Dolphin  ca
               Killer whale  ca
           Tibetan antelope  ca
B D                     Cow  ca
B D                   Sheep  ca
              Domestic goat  ca
B D                   Horse  gg
B D        White rhinoceros  gg
B D                     Cat  tg
B D                     Dog  ca
B D                 Ferret   cg
B D                   Panda  ca
             Pacific walrus  ca
               Weddell seal  ca
           Black flying-fox  ca
B D                 Megabat  ca
              Big brown bat  ca
       David's myotis (bat)  ca
B D                Hedgehog  ca
B D                   Shrew  ca
            Star-nosed mole  ct
B D                Elephant  c-
        Cape elephant shrew  t-
B D                 Manatee  ca
           Cape golden mole  ca
B D                  Tenrec  ta
                   Aardvark  ca
B D               Armadillo  ca
            Golden hamster  ==
              Prairie vole  ==
B D         Chinese hamster  ==
B D                     Rat  ==
B D          Naked mole-rat  ==
                Chinchilla  ==
B D                   Mouse  ==
          Brush-tailed rat  ==
    Lesser Egyptian jerboa  ==
B D              Guinea pig  ==
  D             Rock pigeon  ==
B D         Tasmanian devil  ==
B D                 Opossum  ==
B D                Squirrel  ==
        Chinese tree shrew  ==
B D                Bushbaby  ==

Alignment block 34 of 713 in window, 31658428 - 31658432, 5 bps 
B D                   Human  agggt
B D                   Chimp  agggt
B D                 Gorilla  agggt
B D               Orangutan  agggt
B D                  Gibbon  agggt
B D                  Rhesus  agggt
B D     Crab-eating macaque  agggt
B D                  Baboon  agggt
B D            Green monkey  agggt
B D                Marmoset  agggt
B D         Squirrel monkey  agggt
B D          Naked mole-rat  atggt
B D              Guinea pig  atggt
                 Chinchilla  atggt
           Brush-tailed rat  atggt
B D                  Rabbit  acagt
B D                    Pika  tgggg
B D                     Pig  agggt
B D                  Alpaca  agagc
             Bactrian camel  agagt
B D                 Dolphin  agggt
               Killer whale  agggt
           Tibetan antelope  aaggt
B D                     Cow  aaggt
B D                   Sheep  aaggt
              Domestic goat  aaggt
B D                   Horse  aagga
B D        White rhinoceros  aagga
B D                     Cat  aggat
B D                     Dog  agggt
B D                 Ferret   agggt
B D                   Panda  agggt
             Pacific walrus  agggt
               Weddell seal  agggt
           Black flying-fox  aggat
B D                 Megabat  aggat
              Big brown bat  agggt
       David's myotis (bat)  agggt
B D                Hedgehog  gggg-
B D                   Shrew  aggg-
            Star-nosed mole  agag-
B D                Elephant  aaagt
        Cape elephant shrew  ggagt
B D                 Manatee  agggt
           Cape golden mole  agagt
B D                  Tenrec  aggtt
                   Aardvark  agggt
B D               Armadillo  gggga
            Golden hamster  =====
              Prairie vole  =====
B D         Chinese hamster  =====
B D                     Rat  =====
B D                   Mouse  =====
    Lesser Egyptian jerboa  =====
  D             Rock pigeon  =====
B D         Tasmanian devil  =====
B D                 Opossum  =====
B D                Squirrel  =====
        Chinese tree shrew  =====
B D                Bushbaby  =====

Inserts between block 34 and 35 in window
B D                    Pig 2142bp
B D                  Horse 28bp
B D       White rhinoceros 36bp

Alignment block 35 of 713 in window, 31658433 - 31658436, 4 bps 
B D                   Human  ctaa
B D                   Chimp  ctaa
B D                 Gorilla  ctaa
B D               Orangutan  ctaa
B D                  Gibbon  ctaa
B D                  Rhesus  ctaa
B D     Crab-eating macaque  ctaa
B D                  Baboon  ctaa
B D            Green monkey  ctaa
B D                Marmoset  ctaa
B D         Squirrel monkey  ctaa
B D          Naked mole-rat  ctaa
B D              Guinea pig  ctac
                 Chinchilla  ctaa
           Brush-tailed rat  ctac
B D                  Rabbit  ctaa
B D                    Pika  ctga
B D                   Horse  caaa
B D        White rhinoceros  agaa
B D                     Cat  ctaa
B D                     Dog  ctac
B D                 Ferret   ctta
B D                   Panda  ctaa
             Pacific walrus  ctaa
               Weddell seal  ctaa
           Black flying-fox  agaa
B D                 Megabat  agaa
              Big brown bat  cctc
       David's myotis (bat)  ccaa
B D                Hedgehog  ctag
B D                   Shrew  ctac
            Star-nosed mole  ctcc
B D                Elephant  ccgt
        Cape elephant shrew  cc--
B D                 Manatee  ctgt
           Cape golden mole  ctgc
B D                  Tenrec  ctgt
                   Aardvark  ctgt
B D               Armadillo  ctcc
            Golden hamster  ====
              Prairie vole  ====
B D         Chinese hamster  ====
B D                     Rat  ====
B D                   Mouse  ====
    Lesser Egyptian jerboa  ====
B D                 Dolphin  ----
B D                     Pig  ====
  D             Rock pigeon  ====
B D         Tasmanian devil  ====
B D                 Opossum  ====
              Killer whale  ----
            Bactrian camel  ----
B D                   Sheep  ----
B D                     Cow  ----
          Tibetan antelope  ----
B D                Squirrel  ====
             Domestic goat  ----
B D                  Alpaca  ----
        Chinese tree shrew  ====
B D                Bushbaby  ====

Inserts between block 35 and 36 in window
B D                   Pika 3744bp

Alignment block 36 of 713 in window, 31658437 - 31658437, 1 bps 
B D                   Human  a
B D                   Chimp  a
B D                 Gorilla  a
B D               Orangutan  a
B D                  Gibbon  a
B D                  Rhesus  a
B D     Crab-eating macaque  a
B D                  Baboon  a
B D            Green monkey  a
B D                Marmoset  a
B D         Squirrel monkey  a
B D                  Alpaca  a
             Bactrian camel  a
B D                 Dolphin  g
               Killer whale  a
           Tibetan antelope  a
B D                     Cow  a
B D                   Sheep  a
              Domestic goat  a
B D                   Horse  a
B D        White rhinoceros  a
B D                     Cat  a
B D                     Dog  a
B D                 Ferret   a
B D                   Panda  a
             Pacific walrus  a
               Weddell seal  a
           Black flying-fox  a
B D                 Megabat  a
              Big brown bat  a
       David's myotis (bat)  a
B D                Hedgehog  a
B D                   Shrew  a
            Star-nosed mole  a
B D                Elephant  a
B D                 Manatee  a
           Cape golden mole  a
B D                  Tenrec  a
                   Aardvark  a
B D               Armadillo  a
            Golden hamster  =
B D                    Pika  =
B D                  Rabbit  -
              Prairie vole  =
B D         Chinese hamster  =
B D                     Rat  =
B D          Naked mole-rat  -
       Cape elephant shrew  -
                Chinchilla  -
B D                   Mouse  =
          Brush-tailed rat  -
    Lesser Egyptian jerboa  =
B D              Guinea pig  -
B D                     Pig  =
  D             Rock pigeon  =
B D         Tasmanian devil  =
B D                 Opossum  =
B D                Squirrel  =
        Chinese tree shrew  =
B D                Bushbaby  =

Inserts between block 36 and 37 in window
              Killer whale 5bp
B D               Hedgehog 2400bp
B D                  Shrew 1bp
           Star-nosed mole 1bp

Alignment block 37 of 713 in window, 31658438 - 31658439, 2 bps 
B D                   Human  ta
B D                   Chimp  ta
B D                 Gorilla  ta
B D               Orangutan  ta
B D                  Gibbon  ta
B D                  Rhesus  ta
B D     Crab-eating macaque  ta
B D                  Baboon  ta
B D            Green monkey  ta
B D                Marmoset  ta
B D         Squirrel monkey  ta
B D                  Alpaca  ta
             Bactrian camel  ta
B D                 Dolphin  ta
               Killer whale  tt
           Tibetan antelope  ga
B D                     Cow  ga
B D                   Sheep  ga
              Domestic goat  ga
B D                   Horse  ga
B D        White rhinoceros  ga
B D                     Cat  ta
B D                     Dog  ta
B D                 Ferret   ga
B D                   Panda  ta
             Pacific walrus  ta
               Weddell seal  ta
           Black flying-fox  ta
B D                 Megabat  ta
              Big brown bat  c-
       David's myotis (bat)  ca
B D                   Shrew  ta
            Star-nosed mole  -g
B D                Elephant  t-
B D                 Manatee  t-
           Cape golden mole  t-
B D                  Tenrec  t-
                   Aardvark  t-
B D                Hedgehog  ==
            Golden hamster  ==
B D                    Pika  ==
B D                  Rabbit  --
              Prairie vole  ==
B D         Chinese hamster  ==
B D                     Rat  ==
B D          Naked mole-rat  --
B D               Armadillo  --
       Cape elephant shrew  --
                Chinchilla  --
B D                   Mouse  ==
          Brush-tailed rat  --
    Lesser Egyptian jerboa  ==
B D              Guinea pig  --
B D                     Pig  ==
  D             Rock pigeon  ==
B D         Tasmanian devil  ==
B D                 Opossum  ==
B D                Squirrel  ==
        Chinese tree shrew  ==
B D                Bushbaby  ==

Inserts between block 37 and 38 in window
B D                 Alpaca 4bp
            Bactrian camel 4bp
B D                Dolphin 4bp
              Killer whale 4bp
          Tibetan antelope 2bp
B D                    Cow 2bp
B D                  Sheep 2bp
             Domestic goat 2bp
          Black flying-fox 3bp
B D                Megabat 3bp
      David's myotis (bat) 3257bp

Alignment block 38 of 713 in window, 31658440 - 31658448, 9 bps 
B D                   Human  gcgtaaata
B D                   Chimp  gcgtaaata
B D                 Gorilla  gcgtacata
B D               Orangutan  gcataaata
B D                  Gibbon  gcgtaaata
B D                  Rhesus  acataaata
B D     Crab-eating macaque  acataaata
B D                  Baboon  acataaata
B D            Green monkey  acataaata
B D                Marmoset  acataaata
B D         Squirrel monkey  acataaata
B D                  Alpaca  -----aata
             Bactrian camel  -----aata
B D                 Dolphin  -----aata
               Killer whale  -----aata
           Tibetan antelope  -------ta
B D                     Cow  -------ta
B D                   Sheep  -------ta
              Domestic goat  -------tg
B D                   Horse  -----caga
B D        White rhinoceros  -----caga
B D                     Cat  -----aata
B D                     Dog  -----agta
B D                 Ferret   -----agta
B D                   Panda  -----agca
             Pacific walrus  -----agta
               Weddell seal  -----agta
           Black flying-fox  acagaaata
B D                 Megabat  acagaaata
              Big brown bat  gcacaaaca
B D                   Shrew  ----ctgtg
            Star-nosed mole  ----ctcta
B D                Elephant  -------ta
B D                 Manatee  -------ta
           Cape golden mole  -------ta
B D                  Tenrec  -------ta
                   Aardvark  -------ta
B D                Hedgehog  =========
            Golden hamster  =========
B D                    Pika  =========
B D                  Rabbit  ---------
              Prairie vole  =========
B D         Chinese hamster  =========
B D                     Rat  =========
B D          Naked mole-rat  ---------
B D               Armadillo  ---------
       Cape elephant shrew  ---------
                Chinchilla  ---------
B D                   Mouse  =========
          Brush-tailed rat  ---------
    Lesser Egyptian jerboa  =========
B D              Guinea pig  ---------
B D                     Pig  =========
  D             Rock pigeon  =========
B D         Tasmanian devil  =========
B D                 Opossum  =========
B D                Squirrel  =========
      David's myotis (bat)  =========
        Chinese tree shrew  =========
B D                Bushbaby  =========

Inserts between block 38 and 39 in window
          Black flying-fox 173bp
B D                Megabat 189bp
B D                  Shrew 2780bp
           Star-nosed mole 3bp

Alignment block 39 of 713 in window, 31658449 - 31658451, 3 bps 
B D                   Human  ata
B D                   Chimp  ata
B D                 Gorilla  ata
B D               Orangutan  ata
B D                  Gibbon  ata
B D                  Rhesus  ata
B D     Crab-eating macaque  ata
B D                  Baboon  ata
B D            Green monkey  ata
B D                Marmoset  ata
B D         Squirrel monkey  a--
B D          Naked mole-rat  ata
B D              Guinea pig  aca
                 Chinchilla  gta
           Brush-tailed rat  ata
            Star-nosed mole  -ca
B D                Elephant  cta
B D                 Manatee  cta
           Cape golden mole  cta
B D                  Tenrec  ctg
                   Aardvark  caa
B D                Hedgehog  ===
            Golden hamster  ===
B D                    Pika  ===
B D                   Shrew  ===
B D                  Rabbit  ---
              Prairie vole  ===
B D         Chinese hamster  ===
B D                     Rat  ===
B D               Armadillo  ---
       Cape elephant shrew  ---
B D                   Mouse  ===
    Lesser Egyptian jerboa  ===
B D                 Dolphin  ---
B D                 Megabat  ===
B D                     Pig  ===
              Weddell seal  ---
  D             Rock pigeon  ===
B D         Tasmanian devil  ===
B D                 Opossum  ===
              Killer whale  ---
            Bactrian camel  ---
             Big brown bat  ---
B D                   Sheep  ---
B D                     Cow  ---
          Tibetan antelope  ---
          Black flying-fox  ===
B D                Squirrel  ===
      David's myotis (bat)  ===
B D                     Dog  ---
             Domestic goat  ---
B D                  Alpaca  ---
            Pacific walrus  ---
B D                   Panda  ---
B D                 Ferret   ---
        Chinese tree shrew  ===
B D                     Cat  ---
B D        White rhinoceros  ---
B D                   Horse  ---
B D                Bushbaby  ===

Alignment block 40 of 713 in window, 31658452 - 31658459, 8 bps 
B D                   Human  aataagta
B D                   Chimp  aataagta
B D                 Gorilla  aataagca
B D               Orangutan  aataagta
B D                  Gibbon  aataagta
B D                  Rhesus  aataagta
B D     Crab-eating macaque  aataagta
B D                  Baboon  aataagta
B D            Green monkey  aataagta
B D                Marmoset  agtaagta
B D         Squirrel monkey  --taagta
B D          Naked mole-rat  gacaaata
B D              Guinea pig  gacagata
                 Chinchilla  gataaata
           Brush-tailed rat  gataaata
B D                  Rabbit  -ataaata
B D                  Alpaca  aataagta
             Bactrian camel  aataagta
B D                 Dolphin  aataagtt
               Killer whale  aataagtt
           Tibetan antelope  aataagtc
B D                     Cow  aataagtc
B D                   Sheep  aataagtc
              Domestic goat  aataagtc
B D                   Horse  aggactgg
B D        White rhinoceros  cagactgt
B D                     Cat  a-----at
B D                     Dog  aacaaaat
B D                 Ferret   attgagat
B D                   Panda  aataagaa
             Pacific walrus  aatacgat
               Weddell seal  aataggat
              Big brown bat  --ca----
            Star-nosed mole  -atgaaat
B D                Elephant  aataaaca
        Cape elephant shrew  aaaaggga
B D                 Manatee  aataagca
           Cape golden mole  aataaata
B D                  Tenrec  aataaata
                   Aardvark  aataaata
B D               Armadillo  ---aaata
B D                Hedgehog  ========
            Golden hamster  ========
B D                    Pika  ========
B D                   Shrew  ========
              Prairie vole  ========
B D         Chinese hamster  ========
B D                     Rat  ========
B D                   Mouse  ========
    Lesser Egyptian jerboa  ========
B D                 Megabat  ========
B D                     Pig  ========
  D             Rock pigeon  ========
B D         Tasmanian devil  ========
B D                 Opossum  ========
          Black flying-fox  ========
B D                Squirrel  ========
      David's myotis (bat)  ========
        Chinese tree shrew  ========
B D                Bushbaby  ========

Inserts between block 40 and 41 in window
             Big brown bat 4bp
           Star-nosed mole 1bp

Alignment block 41 of 713 in window, 31658460 - 31658463, 4 bps 
B D                   Human  -aata
B D                   Chimp  -aata
B D                 Gorilla  -aata
B D               Orangutan  -aata
B D                  Gibbon  -aata
B D                  Rhesus  -aata
B D     Crab-eating macaque  -aata
B D                  Baboon  -aata
B D            Green monkey  -aata
B D                Marmoset  -aata
B D         Squirrel monkey  -aata
B D          Naked mole-rat  -aatg
B D              Guinea pig  -aatg
                 Chinchilla  -aatg
           Brush-tailed rat  -actg
B D                  Rabbit  -aaac
           Black flying-fox  -aaag
B D                 Megabat  -aaag
              Big brown bat  -cacg
B D                Elephant  aaata
        Cape elephant shrew  aaata
B D                 Manatee  aaata
           Cape golden mole  aaaga
B D                  Tenrec  ca---
                   Aardvark  aa---
B D               Armadillo  aa---
B D                Hedgehog  =====
            Golden hamster  =====
B D                    Pika  =====
           Star-nosed mole  =====
B D                   Shrew  =====
              Prairie vole  =====
B D         Chinese hamster  =====
B D                     Rat  =====
B D                   Mouse  =====
    Lesser Egyptian jerboa  =====
B D                 Dolphin  -----
B D                     Pig  =====
              Weddell seal  -----
  D             Rock pigeon  =====
B D         Tasmanian devil  =====
B D                 Opossum  =====
              Killer whale  -----
            Bactrian camel  -----
B D                   Sheep  -----
B D                     Cow  -----
          Tibetan antelope  -----
B D                Squirrel  =====
      David's myotis (bat)  =====
B D                     Dog  -----
             Domestic goat  -----
B D                  Alpaca  -----
            Pacific walrus  -----
B D                   Panda  -----
B D                 Ferret   -----
        Chinese tree shrew  =====
B D                     Cat  -----
B D        White rhinoceros  -----
B D                   Horse  -----
B D                Bushbaby  =====

Inserts between block 41 and 42 in window
B D         Naked mole-rat 2bp
B D             Guinea pig 2bp
                Chinchilla 2bp
          Brush-tailed rat 2bp
B D                 Rabbit 1bp

Alignment block 42 of 713 in window, 31658464 - 31658480, 17 bps 
B D                   Human  aatcga-tagtagtgt-ac
B D                   Chimp  aatcga-tagtagtgt-ac
B D                 Gorilla  aatcga-tagtagtgt-ac
B D               Orangutan  aataga-tagtagtgt-ac
B D                  Gibbon  aataga-tagtagtgtaac
B D                  Rhesus  aataga-tagtagtgt-ac
B D     Crab-eating macaque  aataga-tagtagtgt-ac
B D                  Baboon  aataga-tagtagtgt-cc
B D            Green monkey  aataga-tagtagtgt-ac
B D                Marmoset  cataga-taatagtgt-ac
B D         Squirrel monkey  cataga-taacagtgt-at
     Lesser Egyptian jerboa  --aaca-gataaacat-gc
B D          Naked mole-rat  -----------agtgt-gc
B D              Guinea pig  -----------agtgt-ac
                 Chinchilla  -----------agtgt-ac
           Brush-tailed rat  -----------agggt-ac
B D                  Rabbit  aatgca-cagaagtgt-ac
B D                  Alpaca  ----------ctgta--ag
             Bactrian camel  ----------ctgta--ag
B D                 Dolphin  ----------atggac-ag
               Killer whale  ----------atggac-ag
           Tibetan antelope  ----------gtgtgc-ag
B D                     Cow  ----------atgtgc-ag
B D                   Sheep  ----------acgtgc-ag
              Domestic goat  ----------atgtgc-ag
B D                   Horse  ---------aaagcac-aa
B D        White rhinoceros  ---------aaagcat-gg
B D                     Cat  ---------aaagctt-aa
B D                     Dog  ---------caagtgc-ag
B D                 Ferret   ---------aaagtgt-ag
B D                   Panda  ---------aaagtgt-ag
             Pacific walrus  ---------aaagtgt-ag
               Weddell seal  ---------aaagtgt-ag
           Black flying-fox  aactaa-aaaaagggt-ag
B D                 Megabat  aactaa-aaaaagggt-ag
              Big brown bat  gact----------gc-ag
            Star-nosed mole  ----aa-tacatccgt-tg
B D                Elephant  aacaca-agaaagcgt-ag
        Cape elephant shrew  aatatg-tgaaagtat-ag
B D                 Manatee  aatcca-tgaaagcac-ag
           Cape golden mole  agtacattgaaaatgt-ag
B D                  Tenrec  -------tgaaaaggt-ag
                   Aardvark  --taca-tgaaactgt-ag
B D                Hedgehog  ===================
            Golden hamster  ===================
B D                    Pika  ===================
B D                   Shrew  ===================
              Prairie vole  ===================
B D         Chinese hamster  ===================
B D                     Rat  ===================
B D               Armadillo  -------------------
B D                   Mouse  ===================
B D                     Pig  ===================
  D             Rock pigeon  ===================
B D         Tasmanian devil  ===================
B D                 Opossum  ===================
B D                Squirrel  ===================
      David's myotis (bat)  ===================
        Chinese tree shrew  ===================
B D                Bushbaby  ===================

Inserts between block 42 and 43 in window
    Lesser Egyptian jerboa 2bp

Alignment block 43 of 713 in window, 31658481 - 31658498, 18 bps 
B D                   Human  t-----ccaaacga--ggctggaat
B D                   Chimp  t-----ccaaacga--ggctggaat
B D                 Gorilla  t-----cccaacga--ggctggaat
B D               Orangutan  t-----ccaaacaa--ggcaggaat
B D                  Gibbon  t-----ccaaacga--ggctggaat
B D                  Rhesus  t-----ccaaacga--ggctggaat
B D     Crab-eating macaque  t-----ccaaacga--ggctggaat
B D                  Baboon  t-----ccaaacga--ggctggaat
B D            Green monkey  t-----ccaaacga--ggctggaat
B D                Marmoset  t-----ccaaacaa--ggctggagt
B D         Squirrel monkey  t-----ccaaacaa--ggctggagt
     Lesser Egyptian jerboa  c-----ccagatgt--gacccaacc
B D         Chinese hamster  t-----cccaatgt--ggccaaatg
B D          Naked mole-rat  c-----ctgaatgt--aactggagc
B D              Guinea pig  t-----ctgaacgt--ggctggagc
                 Chinchilla  c-----ccaaatgt--ggctgcagc
           Brush-tailed rat  c-----ccaaaggt--ggctggagt
B D                  Rabbit  c-----ccaaacat--ggttggagc
B D                  Alpaca  c-----caagatgtggggctgaagc
             Bactrian camel  c-----caagatgtggggctgaagc
B D                 Dolphin  c-----caagatgt--ggttgaatc
               Killer whale  c-----caagatgt--ggttgaatc
           Tibetan antelope  c-----caagacat--ggctgaagt
B D                     Cow  c-----caagacgt--ggctgaagt
B D                   Sheep  c-----caacacgt--ggctgaagt
              Domestic goat  c-----caacacgt--ggctgaagt
B D                   Horse  c-----ccagacat--ggctggagc
B D        White rhinoceros  c-----ccacacat--ggctgaagc
B D                     Cat  c-----acagatgt--ggctgaagc
B D                     Dog  c-----ccagatgt--ggctgaagc
B D                 Ferret   c-----ccagatga--ggctgaagc
B D                   Panda  c-----ccagatgt--ggctgaagc
             Pacific walrus  c-----ccacatgc--ggctgaagc
               Weddell seal  c-----ccacatgc--ggctgaagc
           Black flying-fox  c-----ccagatgt--ggctgaatc
B D                 Megabat  c-----ccagatgt--ggctgaatc
              Big brown bat  ccgacgccagacgc--ggctggaac
            Star-nosed mole  c-----ccccatgt--gggctgagt
B D                Elephant  c-----ccagatgg--ggctggagc
        Cape elephant shrew  c-----ccaaatat--ggatggcgc
B D                 Manatee  c-----tcagatga--ggctggggc
           Cape golden mole  c-----tcagatgt--ggtaggagc
B D                  Tenrec  c-----ttagttgg--ggctggagc
                   Aardvark  c-----acagatgt--ggc--aagc
B D               Armadillo  ------------ga--ggctggagc
B D                Hedgehog  =========================
            Golden hamster  =========================
B D                    Pika  =========================
B D                   Shrew  =========================
              Prairie vole  =========================
B D                     Rat  =========================
B D                   Mouse  =========================
B D                     Pig  =========================
  D             Rock pigeon  =========================
B D         Tasmanian devil  =========================
B D                 Opossum  =========================
B D                Squirrel  =========================
      David's myotis (bat)  =========================
        Chinese tree shrew  =========================
B D                Bushbaby  =========================

Inserts between block 43 and 44 in window
B D                 Alpaca 1bp
            Bactrian camel 1bp

Alignment block 44 of 713 in window, 31658499 - 31658538, 40 bps 
B D                   Human  agcttctattgttg----tttcacactgga--cttcaattaagt----ct
B D                   Chimp  agcttctattgttg----tttcacactgga--cttcaattaagt----ct
B D                 Gorilla  agcttctattgttg----tttcacactgga--cttcaattaagt----ct
B D               Orangutan  agcttctattgttg----tttcacactgga--cttcaattaagt----ct
B D                  Gibbon  agcttctactgttg----tttcacactgga--cttcaattaagt----ct
B D                  Rhesus  agcttctatcgttg----tttcacgctgga--cttgaattaagt----ct
B D     Crab-eating macaque  agcttctatcgttg----tttcacgctgga--cttgaattaagt----ct
B D                  Baboon  agcttctattgttg----tttcacgctgga--cttgaattaagt----ct
B D            Green monkey  agcttctattgttg----ttttaggccgga--cttgaattaagt----ct
B D                Marmoset  agcttctgttg--------ttcatactgga--cttgaattaagt----ct
B D         Squirrel monkey  agattctgttg--------ttcatactgga--cttgaattcagt----ct
     Lesser Egyptian jerboa  agattcccttcttc----tttcatgctggg--cttgaattaagt----tt
B D         Chinese hamster  agcttctctttttg----tcacaccctggc--ctggagttaggt----gc
B D                     Rat  agttcctcctgttt---------ctctggc--ctagagttaggt----tt
B D          Naked mole-rat  agtttctgttcttg----tttcacacccgg--cttgatctagac----tt
B D              Guinea pig  agtttctgttctta----tttcacactggc--tttgacttagac----ct
                 Chinchilla  agcttctgttcttg----ttacacacgggg--c------tgggc----ct
           Brush-tailed rat  agtttctgttcttg----tttcatagaggg--cttgatttagac----tt
B D                  Rabbit  agc--ctgttcttggttctttcacggcggg--ctgaaattaggc----ct
B D                  Alpaca  agactctg-cttta-----ttcactctggc--cttgaattatgc----ct
             Bactrian camel  agactctg-ctttg----tttcactctggc--cttgaattatgc----ct
B D                 Dolphin  agcttctg-ccttg----tttcactctggc--cttgaactacgt----gt
               Killer whale  agcttctg-ccttg----tttcactctggc--cttgaactacgt----gt
           Tibetan antelope  agtttctg-ccttg----tttcactctgac--cttgaactaggtctcact
B D                     Cow  agtttctg-ccttg----tttcactctgac--cttgaactaggtctcact
B D                   Sheep  agtttctg-ccttg----tttcactctgac--cttgaactaggtctcact
              Domestic goat  agtttctg-ccttg----tttcactctgac--cttgaactaggtctcact
B D                   Horse  agcctctgtccttg----cttcactctggc--cttgaattaggc----ct
B D        White rhinoceros  agcctctgcccttg----tgtcactctggc--cttgaattaggc----ct
B D                     Cat  actccctgccctgg----tgtcactgtggc--cttggattaggt----ct
B D                     Dog  agcctctgtcctag----tttcactctggc--tctgaaggcggc----ct
B D                 Ferret   agcccctgtctttg----ttccactctggc--actgaattaggc----ct
B D                   Panda  agcccctgtcctgg----tttcactctgac--cttgaattaggc----ct
             Pacific walrus  agcccctgtccttg----tttcactctggc--gttgaattaggc----ct
               Weddell seal  agcccctgtccttg----tttcactctggt--gttgaattaggc----ct
           Black flying-fox  accctctgtccttg----tctcactctggc--cttgaatttggc----ct
B D                 Megabat  agcctctgtccttg----tctcactctggc--cttgaattcggc----ct
              Big brown bat  agcctctgcctcgg------ccactctggc--cttggattaggc----ct
            Star-nosed mole  aac--ctgttcttg----tttcacatcagc--cttggatca-gc----ac
B D                Elephant  agcctctgctcttg----actcacactggg--cttggattagga----tc
        Cape elephant shrew  agtctctattcttt----tcttacactggg--cttgtattaagg----cc
B D                 Manatee  agcttctgctctca----cctcacaccggc--tttggattagga----cc
           Cape golden mole  tgtttctgttcttg----tctaacactgg---tttatattagga----ac
B D                  Tenrec  agcctctgctcttg----tctcaccctgagcttatgtataagga----tc
                   Aardvark  agcctctgttcttg----tctcacactgag--tttgtattagga----tc
B D               Armadillo  agcctctgttcttg----tttcatactggg--cttgagttagga----ct
B D                Hedgehog  ==================================================
            Golden hamster  ==================================================
B D                    Pika  ==================================================
B D                   Shrew  ==================================================
              Prairie vole  ==================================================
B D                   Mouse  ==================================================
B D                     Pig  ==================================================
  D             Rock pigeon  ==================================================
B D         Tasmanian devil  ==================================================
B D                 Opossum  ==================================================
B D                Squirrel  ==================================================
      David's myotis (bat)  ==================================================
        Chinese tree shrew  ==================================================
B D                Bushbaby  ==================================================

Inserts between block 44 and 45 in window
    Lesser Egyptian jerboa 370bp

Alignment block 45 of 713 in window, 31658539 - 31658546, 8 bps 
B D                   Human  cagtattt
B D                   Chimp  cagtattt
B D                 Gorilla  cagtattt
B D               Orangutan  cagtattt
B D                  Gibbon  cagtattt
B D                  Rhesus  gagtattt
B D     Crab-eating macaque  gagtattt
B D                  Baboon  gagtattt
B D            Green monkey  gagtattt
B D                Marmoset  cagtattt
B D         Squirrel monkey  cagtattt
B D         Chinese hamster  cggtattt
B D                     Rat  cggtattt
B D          Naked mole-rat  cagtactc
B D              Guinea pig  cagtactc
                 Chinchilla  cagtacac
           Brush-tailed rat  cagtaccc
B D                  Rabbit  caggattt
B D                  Alpaca  cagtgttt
             Bactrian camel  cagtgttt
B D                 Dolphin  cagtgttt
               Killer whale  cagtgttt
           Tibetan antelope  cagcattt
B D                     Cow  cagcattt
B D                   Sheep  cagcattt
              Domestic goat  cagcattt
B D                   Horse  cagtattc
B D        White rhinoceros  cagttatt
B D                     Cat  cagtattt
B D                     Dog  cagtattt
B D                 Ferret   cggtattt
B D                   Panda  cagtattt
             Pacific walrus  cagtattt
               Weddell seal  cagtattt
           Black flying-fox  caggattt
B D                 Megabat  caggattt
              Big brown bat  ccgtgtct
            Star-nosed mole  cactgttt
B D                Elephant  cagtatcc
        Cape elephant shrew  tggtgttc
B D                 Manatee  cagtattc
           Cape golden mole  cagtattc
B D                  Tenrec  cagtat--
                   Aardvark  cagtattc
B D               Armadillo  cagtattt
B D                Hedgehog  ========
            Golden hamster  ========
B D                    Pika  ========
B D                   Shrew  ========
              Prairie vole  ========
B D                   Mouse  ========
    Lesser Egyptian jerboa  ========
B D                     Pig  ========
  D             Rock pigeon  ========
B D         Tasmanian devil  ========
B D                 Opossum  ========
B D                Squirrel  ========
      David's myotis (bat)  ========
        Chinese tree shrew  ========
B D                Bushbaby  ========

Inserts between block 45 and 46 in window
             Big brown bat 1385bp
           Star-nosed mole 6bp

Alignment block 46 of 713 in window, 31658547 - 31658556, 10 bps 
B D                   Human  tgccatactc
B D                   Chimp  tgccatactc
B D                 Gorilla  tgccatgctc
B D               Orangutan  tgccatgctc
B D                  Gibbon  tgccatgctc
B D                  Rhesus  tgccatgctc
B D     Crab-eating macaque  tgccatgctc
B D                  Baboon  taccatgctc
B D            Green monkey  tgccatgctc
B D                Marmoset  tgccatgctc
B D         Squirrel monkey  tgccatgctc
B D         Chinese hamster  cgtcgtcctc
B D                     Rat  tgccatcctc
B D          Naked mole-rat  tgccttcctc
B D              Guinea pig  tgctttcctt
                 Chinchilla  tgctttcatc
           Brush-tailed rat  tgttttcctc
B D                  Rabbit  tgtctggctc
B D                  Alpaca  cgacatcctc
             Bactrian camel  caacgtcctc
B D                 Dolphin  catcatcctt
               Killer whale  catcatcctt
           Tibetan antelope  caccatcccc
B D                     Cow  caccatcccc
B D                   Sheep  catcatcccc
              Domestic goat  caccatcccc
B D                   Horse  tgccatcctc
B D        White rhinoceros  tgccatcctc
B D                     Cat  tgtcatcctc
B D                     Dog  tgtcatcctc
B D                 Ferret   tgtcatcctt
B D                   Panda  tgtcatcctt
             Pacific walrus  tgtcatcctt
               Weddell seal  tgtcatcctt
           Black flying-fox  ttccatcctc
B D                 Megabat  ttccatcctc
            Star-nosed mole  ccacacactc
B D                Elephant  tgacatcgtc
        Cape elephant shrew  tgacatcttc
B D                 Manatee  taccatcttc
           Cape golden mole  tgccatcttc
B D                  Tenrec  -----tcttc
                   Aardvark  tgtcatcttc
B D               Armadillo  tgtcatcctc
B D                Hedgehog  ==========
            Golden hamster  ==========
B D                    Pika  ==========
B D                   Shrew  ==========
              Prairie vole  ==========
B D                   Mouse  ==========
    Lesser Egyptian jerboa  ==========
B D                     Pig  ==========
  D             Rock pigeon  ==========
B D         Tasmanian devil  ==========
B D                 Opossum  ==========
             Big brown bat  ==========
B D                Squirrel  ==========
      David's myotis (bat)  ==========
        Chinese tree shrew  ==========
B D                Bushbaby  ==========

Inserts between block 46 and 47 in window
B D                 Alpaca 789bp
            Bactrian camel 793bp

Alignment block 47 of 713 in window, 31658557 - 31658557, 1 bps 
B D                   Human  a
B D                   Chimp  a
B D                 Gorilla  a
B D               Orangutan  a
B D                  Gibbon  a
B D                  Rhesus  a
B D     Crab-eating macaque  a
B D                  Baboon  a
B D            Green monkey  a
B D                Marmoset  a
B D         Squirrel monkey  a
B D         Chinese hamster  a
B D                     Rat  a
B D          Naked mole-rat  a
B D              Guinea pig  a
                 Chinchilla  a
           Brush-tailed rat  a
B D                  Rabbit  a
B D                 Dolphin  a
               Killer whale  a
           Tibetan antelope  a
B D                     Cow  a
B D                   Sheep  a
              Domestic goat  a
B D                   Horse  a
B D        White rhinoceros  a
B D                     Cat  a
B D                     Dog  a
B D                 Ferret   a
B D                   Panda  a
             Pacific walrus  a
               Weddell seal  a
           Black flying-fox  a
B D                 Megabat  a
            Star-nosed mole  a
B D                Elephant  a
        Cape elephant shrew  a
B D                 Manatee  a
           Cape golden mole  a
B D                  Tenrec  a
                   Aardvark  a
B D               Armadillo  a
B D                Hedgehog  =
            Golden hamster  =
B D                    Pika  =
B D                   Shrew  =
              Prairie vole  =
B D                   Mouse  =
    Lesser Egyptian jerboa  =
B D                     Pig  =
  D             Rock pigeon  =
B D         Tasmanian devil  =
B D                 Opossum  =
            Bactrian camel  =
             Big brown bat  =
B D                Squirrel  =
      David's myotis (bat)  =
B D                  Alpaca  =
        Chinese tree shrew  =
B D                Bushbaby  =

Inserts between block 47 and 48 in window
B D                Dolphin 1bp
              Killer whale 1bp
          Tibetan antelope 1210bp
B D                    Cow 1223bp
B D                  Sheep 1220bp
             Domestic goat 1bp
B D                  Horse 1bp
B D       White rhinoceros 1bp
B D                    Cat 1bp
B D                    Dog 1bp
B D                Ferret  1bp
B D                  Panda 749bp
            Pacific walrus 1bp
              Weddell seal 1bp
          Black flying-fox 784bp
B D                Megabat 783bp

Alignment block 48 of 713 in window, 31658558 - 31658559, 2 bps 
B D                   Human  -a-t
B D                   Chimp  -a-t
B D                 Gorilla  -a-t
B D               Orangutan  -a-t
B D                  Gibbon  -a-t
B D                  Rhesus  -g-t
B D     Crab-eating macaque  -g-t
B D                  Baboon  -g-t
B D            Green monkey  -g-t
B D                Marmoset  -a-a
B D         Squirrel monkey  -a-a
B D         Chinese hamster  -g-a
B D                     Rat  -g-a
B D          Naked mole-rat  -a-a
B D              Guinea pig  -a-a
                 Chinchilla  -a-a
           Brush-tailed rat  -a-a