Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 324 in window, 136130563 - 136130609, 47 bps 
B D                   Human  gtgtctttctgtgtgtgtctgtgtatgtaatggtgtgtctctgtggc
B D                  Rhesus  gtgtctttctgtgtg------tgtgtgtaatggtttgtctctgtggc
B D     Crab-eating macaque  gtgtctttctgtgtg------tgtgtgtaatggtttgtctctgtggc
B D                  Baboon  gtgtctttctgtgtg----tatgtatgtaatggtgtgtctctgtggc
               Green monkey  gtgtctttctgtgtg------tgtgtgtaatggtttgtctctgtggc
         Chinese tree shrew  gtatctgtccgtctg------tgcgtgca------tgtctgtgt---
    Lesser Egyptian jerboa  -----------------------------------------------
B D                    Pika  ===============================================
              Prairie vole  ===============================================
B D               Orangutan  ===============================================
B D                Platypus  ===============================================
B D                  Gibbon  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                  Turkey  ===============================================
B D                 Chicken  ===============================================
  D            Mallard duck  ===============================================
        Tibetan ground jay  ===============================================
B D             Zebra finch  ===============================================
B D         Tasmanian devil  ===============================================
B D           X. tropicalis  ===============================================
  D           Scarlet macaw  ===============================================
B D              Budgerigar  ===============================================
  D             Rock pigeon  ===============================================
B D     Medium ground finch  ===============================================
  D        Peregrine falcon  ===============================================
  D            Saker falcon  ===============================================
  D                  Parrot  ===============================================
              Weddell seal  ===============================================
B D                     Cat  ===============================================
           Star-nosed mole  ===============================================
             Big brown bat  -----------------------------------------------
B D                Marmoset  ===============================================
B D                     Dog  ===============================================
          Black flying-fox  ===============================================
B D        White rhinoceros  ===============================================
B D                   Horse  ===============================================
      David's myotis (bat)  ===============================================
B D                 Gorilla  ===============================================
B D                   Chimp  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Alignment block 2 of 324 in window, 136130610 - 136130786, 177 bps 
B D                   Human  gggga-ggggctgcgtgtgattgtgtgtctgt--------gtgtgtctttctgtgtatgtgtgtgtaatg
B D                  Rhesus  aggga-gggggtgtgtgtgattgtgtgtc------------tgtgtctttctgtgtgtatgtatgtaatg
B D     Crab-eating macaque  aggga-gggggtgtgtgtgattgtgtgtc------------tgtgtctttctgtgtgtatgtatgtaatg
B D                  Baboon  aggga-gggggtgtgtgtgattgtgtgtctgt--------gtgtgtctttctgtgtgtatgtatgtaatg
               Green monkey  agggaggggggtgtgtgtgattgtgtgtc------------tgtg------tgtgtctgtgtatgcaatg
         Chinese tree shrew  ------atccgtgtgtgcggtcatgtctg------------tgtgtgcctgagtgtgcatgtctgca---
B D           X. tropicalis  -gggg-attggtgtgagtgacagtgtgtctgtgagtgtaagtgtgtgtttgtgagtgtatgagtgcaagt
    Lesser Egyptian jerboa  ----------------------------------------------------------------------
B D                    Pika  ======================================================================
              Prairie vole  ======================================================================
B D               Orangutan  ======================================================================
B D                Platypus  ======================================================================
B D                  Gibbon  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                  Turkey  ======================================================================
B D                 Chicken  ======================================================================
  D            Mallard duck  ======================================================================
        Tibetan ground jay  ======================================================================
B D             Zebra finch  ======================================================================
B D         Tasmanian devil  ======================================================================
  D           Scarlet macaw  ======================================================================
B D              Budgerigar  ======================================================================
  D             Rock pigeon  ======================================================================
B D     Medium ground finch  ======================================================================
  D        Peregrine falcon  ======================================================================
  D            Saker falcon  ======================================================================
  D                  Parrot  ======================================================================
              Weddell seal  ======================================================================
B D                     Cat  ======================================================================
           Star-nosed mole  ======================================================================
             Big brown bat  ----------------------------------------------------------------------
B D                Marmoset  ======================================================================
B D                     Dog  ======================================================================
          Black flying-fox  ======================================================================
B D        White rhinoceros  ======================================================================
B D                   Horse  ======================================================================
      David's myotis (bat)  ======================================================================
B D                 Gorilla  ======================================================================
B D                   Chimp  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                      Human  gtgtgtttctgtggccggaagggcgtatctgcgat----------tgcgtgtctgtgtatgtaatggtgt
                     Rhesus  gtgtgtctctgtggtggggaggg-gtatgtgtgattgtgtgtctgtgtgtgtctgtgtatgtaatggtat
        Crab-eating macaque  gtgtgtctctgtggtggggaggg-gtatgtgtgattgtgtgtctgtgtgtgtctgtgtatgtaatggtat
                     Baboon  gtgtgtctctgtggcagggaggg-gtgtgtgtgattgtgtgtctgtgtgtgcctgtgtatgcaatggtgt
               Green monkey  gtgtatctctgtggtggggaggg-gtatgtgtgat----tgtctgtgtgtgtctgtgtatgtaatggtgt
         Chinese tree shrew  ---tattt-------------gg-gtatc----------cgtctgtgcatgcatgtctgtgtatctgtgt
              X. tropicalis  gtgtgt----gtgtctgtgagtgtgtgtctgtgagtgtgtgtctgtgagtgtaagtgtgagtgtgtgttt
     Lesser Egyptian jerboa  ----------------------------------------------------------------------
                       Pika  ======================================================================
               Prairie vole  ======================================================================
                  Orangutan  ======================================================================
                   Platypus  ======================================================================
                     Gibbon  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                     Turkey  ======================================================================
                    Chicken  ======================================================================
               Mallard duck  ======================================================================
         Tibetan ground jay  ======================================================================
                Zebra finch  ======================================================================
            Tasmanian devil  ======================================================================
              Scarlet macaw  ======================================================================
                 Budgerigar  ======================================================================
                Rock pigeon  ======================================================================
        Medium ground finch  ======================================================================
           Peregrine falcon  ======================================================================
               Saker falcon  ======================================================================
                     Parrot  ======================================================================
               Weddell seal  ======================================================================
                        Cat  ======================================================================
            Star-nosed mole  ======================================================================
              Big brown bat  ----------------------------------------------------------------------
                   Marmoset  ======================================================================
                        Dog  ======================================================================
           Black flying-fox  ======================================================================
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
       David's myotis (bat)  ======================================================================
                    Gorilla  ======================================================================
                      Chimp  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                      Human  gtctctgtggcggggagggtgtgtgtgtgattttgtgtctgtg----tctttctgtgtgt
                     Rhesus  gtctctgtggcggggaggg--ggtgtgtgattttgtgtctgtgtgtgtcttgctgtg---
        Crab-eating macaque  gtctctgtggcggggaggg--ggtgtgtgattttgtgtctgtgtgtgtctttctgtgtgt
                     Baboon  gtctctgtggtggggaggg--tatgtgtgattgtgtgtcagtg-----------------
               Green monkey  gtctctttggcggggagggaatgtgtgtgatcgtgtgtctgtg--tgtctttctgtgtgt
         Chinese tree shrew  gctt--------------------------------------------------------
              X. tropicalis  gtgagtgtgtctgtgagtgcaagtgtgtgtttgtgagtgcaagtgtgtgt----------
     Lesser Egyptian jerboa  ------------------------------------------------------------
                       Pika  ============================================================
               Prairie vole  ============================================================
                  Orangutan  ============================================================
                   Platypus  ============================================================
                     Gibbon  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                     Turkey  ============================================================
                    Chicken  ============================================================
               Mallard duck  ============================================================
         Tibetan ground jay  ============================================================
                Zebra finch  ============================================================
            Tasmanian devil  ============================================================
              Scarlet macaw  ============================================================
                 Budgerigar  ============================================================
                Rock pigeon  ============================================================
        Medium ground finch  ============================================================
           Peregrine falcon  ============================================================
               Saker falcon  ============================================================
                     Parrot  ============================================================
               Weddell seal  ============================================================
                        Cat  ============================================================
            Star-nosed mole  ============================================================
              Big brown bat  ------------------------------------------------------------
                   Marmoset  ============================================================
                        Dog  ============================================================
           Black flying-fox  ============================================================
           White rhinoceros  ============================================================
                      Horse  ============================================================
       David's myotis (bat)  ============================================================
                    Gorilla  ============================================================
                      Chimp  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Alignment block 3 of 324 in window, 136130787 - 136130793, 7 bps 
B D                   Human  gtctgtg
B D                 Gorilla  gtctgtg
B D     Crab-eating macaque  ctctgtg
               Green monkey  gtctgtg
         Chinese tree shrew  gtctgtg
B D           X. tropicalis  gtctgtg
    Lesser Egyptian jerboa  -------
B D                    Pika  =======
              Prairie vole  =======
B D                  Baboon  -------
B D               Orangutan  =======
B D                Platypus  =======
B D                  Rhesus  -------
B D                  Gibbon  NNNNNNN
B D                  Turkey  =======
B D                 Chicken  =======
  D            Mallard duck  =======
        Tibetan ground jay  =======
B D             Zebra finch  =======
B D         Tasmanian devil  =======
  D           Scarlet macaw  =======
B D              Budgerigar  =======
  D             Rock pigeon  =======
B D     Medium ground finch  =======
  D        Peregrine falcon  =======
  D            Saker falcon  =======
  D                  Parrot  =======
              Weddell seal  =======
B D                     Cat  =======
           Star-nosed mole  =======
             Big brown bat  -------
B D                Marmoset  =======
B D                     Dog  =======
          Black flying-fox  =======
B D        White rhinoceros  =======
B D                   Horse  =======
      David's myotis (bat)  =======
B D                   Chimp  NNNNNNN

Inserts between block 3 and 4 in window
B D    Crab-eating macaque 46bp

Alignment block 4 of 324 in window, 136130794 - 136130802, 9 bps 
B D                   Human  tatgtaatg
B D                 Gorilla  tatgtaatg
B D                  Rhesus  -------t-
B D                  Baboon  tatgtaatg
               Green monkey  tatgtaatg
         Chinese tree shrew  tcccca---
B D           X. tropicalis  agtgt----
    Lesser Egyptian jerboa  ---------
B D                    Pika  =========
              Prairie vole  =========
B D               Orangutan  =========
B D                Platypus  =========
B D     Crab-eating macaque  =========
B D                  Gibbon  NNNNNNNNN
B D                  Turkey  =========
B D                 Chicken  =========
  D            Mallard duck  =========
        Tibetan ground jay  =========
B D             Zebra finch  =========
B D         Tasmanian devil  =========
  D           Scarlet macaw  =========
B D              Budgerigar  =========
  D             Rock pigeon  =========
B D     Medium ground finch  =========
  D        Peregrine falcon  =========
  D            Saker falcon  =========
  D                  Parrot  =========
              Weddell seal  =========
B D                     Cat  =========
           Star-nosed mole  =========
             Big brown bat  ---------
B D                Marmoset  =========
B D                     Dog  =========
          Black flying-fox  =========
B D        White rhinoceros  =========
B D                   Horse  =========
      David's myotis (bat)  =========
B D                   Chimp  NNNNNNNNN

Inserts between block 4 and 5 in window
B D                 Baboon 2bp
              Green monkey 2bp

Alignment block 5 of 324 in window, 136130803 - 136130823, 21 bps 
B D                   Human  gtg--tctctgtggcgggga-ggg
B D                 Gorilla  gtgcgtctctgtagcaggaa-gag
B D                  Rhesus  --g--tctctgtggcgggga--gg
B D     Crab-eating macaque  gtg--tctctgtggcggggagggg
B D                  Baboon  gtg--tctctgtggcgggga-ggg
               Green monkey  gtg--tctctgtggcgggga-ggg
         Chinese tree shrew  -tg--tctcttgggggaggc-agg
B D        White rhinoceros  gtg--tgcctgaggccgcgt-gtg
B D           X. tropicalis  gtg--tgtctgc---------gag
    Lesser Egyptian jerboa  ------------------------
B D                    Pika  ========================
              Prairie vole  ========================
B D               Orangutan  ========================
B D                Platypus  ========================
B D                  Gibbon  NNNNNNNNNNNNNNNNNNNNNNNN
B D                  Turkey  ========================
B D                 Chicken  ========================
  D            Mallard duck  ========================
        Tibetan ground jay  ========================
B D             Zebra finch  ========================
B D         Tasmanian devil  ========================
  D           Scarlet macaw  ========================
B D              Budgerigar  ========================
  D             Rock pigeon  ========================
B D     Medium ground finch  ========================
  D        Peregrine falcon  ========================
  D            Saker falcon  ========================
  D                  Parrot  ========================
              Weddell seal  ========================
B D                     Cat  ========================
           Star-nosed mole  ========================
             Big brown bat  ------------------------
B D                Marmoset  ========================
B D                     Dog  ========================
          Black flying-fox  ========================
B D                   Horse  ========================
      David's myotis (bat)  ========================
B D                   Chimp  NNNNNNNNNNNNNNNNNNNNNNNN

Alignment block 6 of 324 in window, 136130824 - 136130854, 31 bps 
B D                   Human  tgtgtgtgtgattttgtgtctgtgtgtgtct
B D                 Gorilla  ggtgtgtgtgatt--gtgtgtatttgtgtct
B D                  Rhesus  ggggtgtgtgattttgtatccatgtgtgtct
B D     Crab-eating macaque  ggggtgtgtgattttgtgtctgtgtgtgtct
B D                  Baboon  aatgtgtgtgatcgtgtgtc--tgtgtgtct
               Green monkey  aatgtgtgtgatcgtgtgtc--tgtgta---
         Chinese tree shrew  a-----tatgaccctaggcctgcctg-----
B D        White rhinoceros  tgtttgtgtgagtgtgagtgtgtgagtgtgt
B D           X. tropicalis  tgtgtgtgtgagtgtgtgtgtgtgtgtctgt
B D               Zebrafish  tatatatatatatatatatatatatatatat
    Lesser Egyptian jerboa  -------------------------------
B D                    Pika  ===============================
              Prairie vole  ===============================
B D               Orangutan  ===============================
B D                Platypus  ===============================
B D                  Gibbon  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                  Turkey  ===============================
B D                 Chicken  ===============================
  D            Mallard duck  ===============================
        Tibetan ground jay  ===============================
B D             Zebra finch  ===============================
B D         Tasmanian devil  ===============================
  D           Scarlet macaw  ===============================
B D              Budgerigar  ===============================
  D             Rock pigeon  ===============================
B D     Medium ground finch  ===============================
  D        Peregrine falcon  ===============================
  D            Saker falcon  ===============================
  D                  Parrot  ===============================
              Weddell seal  ===============================
B D                     Cat  ===============================
           Star-nosed mole  ===============================
             Big brown bat  -------------------------------
B D                Marmoset  ===============================
B D                     Dog  ===============================
          Black flying-fox  ===============================
B D                   Horse  ===============================
      David's myotis (bat)  ===============================
B D                   Chimp  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Alignment block 7 of 324 in window, 136130855 - 136130871, 17 bps 
B D                   Human  ttctgtgtgtgtctgtg
B D                   Chimp  ttctgtgtgtgtctgtg
B D                 Gorilla  ttctgtgtgtgtctgtg
B D                  Rhesus  ttctgtgtgtctctgtg
B D     Crab-eating macaque  ttctgtgtgt-------
B D                  Baboon  ttctgtgtgtgtccgtg
               Green monkey  -tctgtgtgtgtctgtg
B D        White rhinoceros  gtgtgtgtgtggcaggg
B D           X. tropicalis  gagtgtgtgtgtgtgtg
B D               Zebrafish  atatatatatatatata
    Lesser Egyptian jerboa  -----------------
B D                    Pika  =================
              Prairie vole  =================
B D               Orangutan  =================
B D                Platypus  =================
B D                  Gibbon  NNNNNNNNNNNNNNNNN
B D                  Turkey  =================
B D                 Chicken  =================
  D            Mallard duck  =================
        Tibetan ground jay  =================
B D             Zebra finch  =================
B D         Tasmanian devil  =================
  D           Scarlet macaw  =================
B D              Budgerigar  =================
  D             Rock pigeon  =================
B D     Medium ground finch  =================
  D        Peregrine falcon  =================
  D            Saker falcon  =================
  D                  Parrot  =================
              Weddell seal  =================
        Chinese tree shrew  -----------------
B D                     Cat  =================
           Star-nosed mole  =================
             Big brown bat  -----------------
B D                Marmoset  =================
B D                     Dog  =================
          Black flying-fox  =================
B D                   Horse  =================
      David's myotis (bat)  =================

Inserts between block 7 and 8 in window
B D                 Rhesus 46bp

Alignment block 8 of 324 in window, 136130872 - 136130880, 9 bps 
B D                   Human  tatgtaatg-
B D                   Chimp  tatgtaatg-
B D                 Gorilla  tatgtcatg-
B D                  Baboon  tatgtaatg-
               Green monkey  tatgtaatg-
B D        White rhinoceros  -gtgtagcg-
B D           X. tropicalis  tatgtgagt-
B D               Zebrafish  tatatacaca
    Lesser Egyptian jerboa  ----------
B D                    Pika  ==========
              Prairie vole  ==========
B D               Orangutan  ==========
B D                Platypus  ==========
B D     Crab-eating macaque  ----------
B D                  Rhesus  ==========
B D                  Gibbon  NNNNNNNNNN
B D                  Turkey  ==========
B D                 Chicken  ==========
  D            Mallard duck  ==========
        Tibetan ground jay  ==========
B D             Zebra finch  ==========
B D         Tasmanian devil  ==========
  D           Scarlet macaw  ==========
B D              Budgerigar  ==========
  D             Rock pigeon  ==========
B D     Medium ground finch  ==========
  D        Peregrine falcon  ==========
  D            Saker falcon  ==========
  D                  Parrot  ==========
              Weddell seal  ==========
        Chinese tree shrew  ----------
B D                     Cat  ==========
           Star-nosed mole  ==========
             Big brown bat  ----------
B D                Marmoset  ==========
B D                     Dog  ==========
          Black flying-fox  ==========
B D                   Horse  ==========
      David's myotis (bat)  ==========

Inserts between block 8 and 9 in window
B D                 Baboon 2bp
              Green monkey 2bp
B D       White rhinoceros 2bp

Alignment block 9 of 324 in window, 136130881 - 136130881, 1 bps 
B D                   Human  g
B D                   Chimp  g
B D                 Gorilla  g
B D                  Rhesus  g
B D                  Baboon  g
               Green monkey  g
B D        White rhinoceros  g
B D           X. tropicalis  g
B D               Zebrafish  g
    Lesser Egyptian jerboa  -
B D                    Pika  =
              Prairie vole  =
B D               Orangutan  =
B D                Platypus  =
B D     Crab-eating macaque  -
B D                  Gibbon  N
B D                  Turkey  =
B D                 Chicken  =
  D            Mallard duck  =
        Tibetan ground jay  =
B D             Zebra finch  =
B D         Tasmanian devil  =
  D           Scarlet macaw  =
B D              Budgerigar  =
  D             Rock pigeon  =
B D     Medium ground finch  =
  D        Peregrine falcon  =
  D            Saker falcon  =
  D                  Parrot  =
              Weddell seal  =
        Chinese tree shrew  -
B D                     Cat  =
           Star-nosed mole  =
             Big brown bat  -
B D                Marmoset  =
B D                     Dog  =
          Black flying-fox  =
B D                   Horse  =
      David's myotis (bat)  =

Alignment block 10 of 324 in window, 136130882 - 136130908, 27 bps 
B D                   Human  tgtc--tctgtggtggggagggggtgtgt
B D                   Chimp  tgtc--tctgtggcggggagggggtgtgt
B D                 Gorilla  tgtc--tctgtggcggggagggggtgtgt
B D                  Rhesus  tgtc--tctgtggcgaggaaggggtgtgt
B D     Crab-eating macaque  ---c--tctgtggcgaggaaggggtgtgt
B D                  Baboon  tgtc--tctgtggcgggaagggggtgtgt
               Green monkey  tgtc--tctgtggcggggagggggtgtgt
B D        White rhinoceros  ggccggcctgtaccggggaggggcggtg-
B D                Platypus  tgtc--ttctgaataagcaggaaatggga
B D           X. tropicalis  ------tgtgtgtctgtgagtgtgtgtgt
B D               Zebrafish  taca--tatgtgtgtgcgtgcgtgcgtgt
    Lesser Egyptian jerboa  -----------------------------
B D                    Pika  =============================
              Prairie vole  =============================
B D               Orangutan  =============================
B D                  Gibbon  NNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                  Turkey  =============================
B D                 Chicken  =============================
  D            Mallard duck  =============================
        Tibetan ground jay  =============================
B D             Zebra finch  =============================
B D         Tasmanian devil  =============================
  D           Scarlet macaw  =============================
B D              Budgerigar  =============================
  D             Rock pigeon  =============================
B D     Medium ground finch  =============================
  D        Peregrine falcon  =============================
  D            Saker falcon  =============================
  D                  Parrot  =============================
              Weddell seal  =============================
        Chinese tree shrew  -----------------------------
B D                     Cat  =============================
           Star-nosed mole  =============================
             Big brown bat  -----------------------------
B D                Marmoset  =============================
B D                     Dog  =============================
          Black flying-fox  =============================
B D                   Horse  =============================
      David's myotis (bat)  =============================

Alignment block 11 of 324 in window, 136130909 - 136130911, 3 bps 
B D                   Human  gtg
B D                   Chimp  gtg
B D                 Gorilla  gtg
B D                  Rhesus  gtg
B D     Crab-eating macaque  gtg
B D                  Baboon  gtg
               Green monkey  gtg
B D                Marmoset  gtg
         Chinese tree shrew  --a
B D                Platypus  att
B D           X. tropicalis  gtg
B D               Zebrafish  gta
    Lesser Egyptian jerboa  ---
B D                    Pika  ===
              Prairie vole  ===
B D               Orangutan  ===
B D                  Gibbon  NNN
B D                  Turkey  ===
B D                 Chicken  ===
  D            Mallard duck  ===
        Tibetan ground jay  ===
B D             Zebra finch  ===
B D         Tasmanian devil  ===
  D           Scarlet macaw  ===
B D              Budgerigar  ===
  D             Rock pigeon  ===
B D     Medium ground finch  ===
  D        Peregrine falcon  ===
  D            Saker falcon  ===
  D                  Parrot  ===
              Weddell seal  ===
B D                     Cat  ===
           Star-nosed mole  ===
             Big brown bat  ---
B D                     Dog  ===
          Black flying-fox  ===
B D        White rhinoceros  ---
B D                   Horse  ===
      David's myotis (bat)  ===

Alignment block 12 of 324 in window, 136130912 - 136130924, 13 bps 
B D                   Human  -atttgaggtgggg
B D                   Chimp  -atttgaggtgggg
B D                 Gorilla  -atttgaggtgggg
B D                  Rhesus  -atttgaggtgggg
B D     Crab-eating macaque  -atttgaggtgggg
B D                  Baboon  -atttgaggtgggg
               Green monkey  -atttgaggtgggg
B D                Marmoset  -atttgaggtgggg
         Chinese tree shrew  -cttcgacttgggg
B D                Platypus  -acctgaagcaagt
B D               Zebrafish  tttatatggtggg-
    Lesser Egyptian jerboa  --------------
B D                    Pika  ==============
              Prairie vole  ==============
B D               Orangutan  ==============
B D                  Gibbon  NNNNNNNNNNNNNN
B D                  Turkey  ==============
B D                 Chicken  ==============
  D            Mallard duck  ==============
        Tibetan ground jay  ==============
B D             Zebra finch  ==============
B D         Tasmanian devil  ==============
B D           X. tropicalis  ==============
  D           Scarlet macaw  ==============
B D              Budgerigar  ==============
  D             Rock pigeon  ==============
B D     Medium ground finch  ==============
  D        Peregrine falcon  ==============
  D            Saker falcon  ==============
  D                  Parrot  ==============
              Weddell seal  ==============
B D                     Cat  ==============
           Star-nosed mole  ==============
             Big brown bat  --------------
B D                     Dog  ==============
          Black flying-fox  ==============
B D        White rhinoceros  --------------
B D                   Horse  ==============
      David's myotis (bat)  ==============

Alignment block 13 of 324 in window, 136130925 - 136130931, 7 bps 
B D                   Human  acggggc--
B D                   Chimp  acggggc--
B D                 Gorilla  acggggc--
B D                  Rhesus  gtgagac--
B D     Crab-eating macaque  gtgagac--
B D                  Baboon  gtgagac--
               Green monkey  gtgagac--
B D                Marmoset  gcagggc--
B D                Platypus  tacattc--
  D            Saker falcon  acaggtt--
  D        Peregrine falcon  acaggtt--
B D               Zebrafish  --ggggctc
    Lesser Egyptian jerboa  ---------
B D                    Pika  =========
              Prairie vole  =========
B D               Orangutan  =========
B D                  Gibbon  NNNNNNNNN
B D                  Turkey  =========
B D                 Chicken  =========
  D            Mallard duck  =========
        Tibetan ground jay  =========
B D             Zebra finch  =========
B D         Tasmanian devil  =========
B D           X. tropicalis  =========
  D           Scarlet macaw  =========
B D              Budgerigar  =========
  D             Rock pigeon  =========
B D     Medium ground finch  =========
  D                  Parrot  =========
              Weddell seal  =========
        Chinese tree shrew  ---------
B D                     Cat  =========
           Star-nosed mole  =========
             Big brown bat  ---------
B D                     Dog  =========
          Black flying-fox  =========
B D        White rhinoceros  ---------
B D                   Horse  =========
      David's myotis (bat)  =========

Alignment block 14 of 324 in window, 136130932 - 136130947, 16 bps 
B D                   Human  ctaggcttcagtta---ct-
B D                   Chimp  ctaggcttcagtta---ct-
B D                 Gorilla  ctaggcttcagtta---ct-
B D                  Rhesus  ctaggcttcagtta---ct-
B D     Crab-eating macaque  ctaggcttcagtta---ct-
B D                  Baboon  ctaggcttcagtta---ct-
               Green monkey  ctaggcttcagtta---ct-
B D                Marmoset  ctaggtttcaattg---tt-
         Chinese tree shrew  ctaggcttcggccagctct-
B D        White rhinoceros  ctaggcctcaacaa---tt-
               Weddell seal  ctggg-ctccacag---tt-
B D                Platypus  ctccctttcagctg---at-
  D            Saker falcon  ccttgctcagtttg---tt-
  D        Peregrine falcon  ccttgctcagtttg---tt-
B D               Zebrafish  caatgtttgtatat---gtt
    Lesser Egyptian jerboa  --------------------
B D                    Pika  ====================
              Prairie vole  ====================
B D               Orangutan  ====================
B D                  Gibbon  NNNNNNNNNNNNNNNNNNNN
B D                  Turkey  ====================
B D                 Chicken  ====================
  D            Mallard duck  ====================
        Tibetan ground jay  ====================
B D             Zebra finch  ====================
B D         Tasmanian devil  ====================
B D           X. tropicalis  ====================
  D           Scarlet macaw  ====================
B D              Budgerigar  ====================
  D             Rock pigeon  ====================
B D     Medium ground finch  ====================
  D                  Parrot  ====================
B D                     Cat  ====================
           Star-nosed mole  ====================
             Big brown bat  --------------------
B D                     Dog  ====================
          Black flying-fox  ====================
B D                   Horse  ====================
      David's myotis (bat)  ====================

Inserts between block 14 and 15 in window
B D       White rhinoceros 3bp
              Weddell seal 3bp

Alignment block 15 of 324 in window, 136130948 - 136130965, 18 bps 
B D                   Human  cacaac-aggacgga--caaa
B D                   Chimp  cacaac-aggacgga--caaa
B D                 Gorilla  cacaac-aggacgga--caaa
B D                  Rhesus  cgcaac-aggacaga--caaa
B D     Crab-eating macaque  cgcaac-aggacaga--caaa
B D                  Baboon  cgcaac-aggacaga--caaa
               Green monkey  cgcaac-ag----ga--caaa
B D                Marmoset  ttcaac-aggacgga--aaaa
         Chinese tree shrew  ctccac-tggccaggttctgc
B D                   Horse  cgcaacaaggacaga--aaaa
B D        White rhinoceros  ctcaac-aggacaga--aaa-
               Weddell seal  ctcaag-gggacaga--agta
B D                Platypus  cacaaa-gacaataa--aaag
  D            Saker falcon  cacact-gggaacaa--aaat
  D        Peregrine falcon  cacact-gggaacaa--aaat
B D               Zebrafish  tatggg-gggggccc--caaa
    Lesser Egyptian jerboa  ---------------------
B D                    Pika  =====================
              Prairie vole  =====================
B D               Orangutan  =====================
B D                  Gibbon  NNNNNNNNNNNNNNNNNNNNN
B D                  Turkey  =====================
B D                 Chicken  =====================
  D            Mallard duck  =====================
        Tibetan ground jay  =====================
B D             Zebra finch  =====================
B D         Tasmanian devil  =====================
B D           X. tropicalis  =====================
  D           Scarlet macaw  =====================
B D              Budgerigar  =====================
  D             Rock pigeon  =====================
B D     Medium ground finch  =====================
  D                  Parrot  =====================
B D                     Cat  =====================
           Star-nosed mole  =====================
             Big brown bat  ---------------------
B D                     Dog  =====================
          Black flying-fox  =====================
      David's myotis (bat)  =====================

Alignment block 16 of 324 in window, 136130966 - 136130968, 3 bps 
B D                   Human  gga-
B D                   Chimp  gga-
B D                 Gorilla  ggg-
B D                  Rhesus  gga-
B D     Crab-eating macaque  gga-
B D                  Baboon  gga-
               Green monkey  gga-
B D                Marmoset  aga-
         Chinese tree shrew  tgg-
B D                   Horse  gga-
B D        White rhinoceros  -gc-
               Weddell seal  gga-
B D                Platypus  gaa-
  D            Saker falcon  tga-
  D        Peregrine falcon  tga-
B D              Budgerigar  gga-
B D               Zebrafish  -gaa
    Lesser Egyptian jerboa  ----
B D                    Pika  ====
              Prairie vole  ====
B D               Orangutan  ====
B D                  Gibbon  NNNN
B D                  Turkey  ====
B D                 Chicken  ====
  D            Mallard duck  ====
        Tibetan ground jay  ====
B D             Zebra finch  ====
B D         Tasmanian devil  ====
B D           X. tropicalis  ====
  D           Scarlet macaw  ====
  D             Rock pigeon  ====
B D     Medium ground finch  ====
  D                  Parrot  ====
B D                     Cat  ====
           Star-nosed mole  ====
             Big brown bat  ----
B D                     Dog  ====
          Black flying-fox  ====
      David's myotis (bat)  ====

Inserts between block 16 and 17 in window
  D           Saker falcon 25bp
  D       Peregrine falcon 25bp
B D             Budgerigar 3bp

Alignment block 17 of 324 in window, 136130969 - 136130975, 7 bps 
B D                   Human  ---aacagag
B D                   Chimp  ---aacagag
B D                 Gorilla  ---aacagag
B D                  Rhesus  ---agccgcg
B D     Crab-eating macaque  ---agccgcg
B D                  Baboon  ---agcagcg
               Green monkey  ---agcagcg
B D                Marmoset  ---agcggac
         Chinese tree shrew  ---agctg--
B D                   Horse  ---agtgagg
B D        White rhinoceros  ---agtggag
               Weddell seal  ---a------
B D                Platypus  ---agcagtg
  D            Saker falcon  ---aata---
  D        Peregrine falcon  ---aata---
B D             Zebra finch  ---agca---
B D              Budgerigar  ---aata---
B D               Zebrafish  aaaggtt---
    Lesser Egyptian jerboa  ----------
B D                    Pika  ==========
              Prairie vole  ==========
B D               Orangutan  ==========
B D                  Gibbon  NNNNNNNNNN
B D                  Turkey  ==========
B D                 Chicken  ==========
  D            Mallard duck  ==========
        Tibetan ground jay  ==========
B D         Tasmanian devil  ==========
B D           X. tropicalis  ==========
  D           Scarlet macaw  ==========
  D             Rock pigeon  ==========
B D     Medium ground finch  ==========
  D                  Parrot  ==========
B D                     Cat  ==========
           Star-nosed mole  ==========
             Big brown bat  ----------
B D                     Dog  ==========
          Black flying-fox  ==========
      David's myotis (bat)  ==========

Inserts between block 17 and 18 in window
B D               Platypus 24bp

Alignment block 18 of 324 in window, 136130976 - 136131006, 31 bps 
B D                   Human  tttacccg-ttctg---------ctaaaac--------caagggcggga
B D                   Chimp  tttacccg-ttctg---------ctaaaac--------caagggcggga
B D                 Gorilla  tttacccg-ttctg---------ctaaaac--------caagggcggga
B D                  Rhesus  tttacccg-ttctg---------ctaacac--------caagggcagga
B D     Crab-eating macaque  tttacccg-ttctg---------ctaaaac--------caagggcagga
B D                  Baboon  tttacccg-ttccg---------ctaaaac--------caagggcggga
               Green monkey  tttacccg-ttctg---------ctaaaac--------caagggcggga
B D                Marmoset  tttatcca-ttctt---------ctaaaac--------caagggtggga
         Chinese tree shrew  -------g-ttctg---------cta------------tgtggcagggg
B D                   Horse  -ttaccca-gcctg---------ttataaaggtccccatcagggcagcg
B D        White rhinoceros  -ctgccgg-gtctg---------cgatgaaggttccgatcagggcggc-
               Weddell seal  ----------cctg---------ctctgacggctc--------------
  D            Saker falcon  ttcagtgg-gtttga--------ttgtgt--------------------
  D        Peregrine falcon  ttcagtgg-gtttga--------ttgtgt--------------------
B D             Zebra finch  cgttcccgtgctggagaccctggccaaga--------------------
B D              Budgerigar  tttagtca-gtttgagaacaagtgtgtgt--------------------
B D               Zebrafish  gggaacca-ctgag---------ctagata--------aagtggtaaaa
    Lesser Egyptian jerboa  -------------------------------------------------
B D                    Pika  =================================================
              Prairie vole  =================================================
B D               Orangutan  =================================================
B D                Platypus  =================================================
B D                  Gibbon  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                  Turkey  =================================================
B D                 Chicken  =================================================
  D            Mallard duck  =================================================
        Tibetan ground jay  =================================================
B D         Tasmanian devil  =================================================
B D           X. tropicalis  =================================================
  D           Scarlet macaw  =================================================
  D             Rock pigeon  =================================================
B D     Medium ground finch  =================================================
  D                  Parrot  =================================================
B D                     Cat  =================================================
           Star-nosed mole  =================================================
             Big brown bat  -------------------------------------------------
B D                     Dog  =================================================
          Black flying-fox  =================================================
      David's myotis (bat)  =================================================

Inserts between block 18 and 19 in window
B D                  Horse 9bp
B D       White rhinoceros 9bp

Alignment block 19 of 324 in window, 136131007 - 136131012, 6 bps 
B D                   Human  ggggga
B D                   Chimp  ggggga
B D                 Gorilla  ggggga
B D                  Rhesus  ggggga
B D     Crab-eating macaque  ggggga
B D                  Baboon  ggggga
               Green monkey  ggggga
B D                Marmoset  gggaga
         Chinese tree shrew  aggggg
     Lesser Egyptian jerboa  gggcca
B D                   Horse  gcgaca
B D        White rhinoceros  gggaga
  D            Saker falcon  ggagga
  D        Peregrine falcon  ggagga
B D             Zebra finch  gcagca
B D              Budgerigar  gtagga
B D               Zebrafish  -taaga
B D                    Pika  ======
              Prairie vole  ======
B D               Orangutan  ======
B D                Platypus  ======
B D                  Gibbon  NNNNNN
B D                  Turkey  ======
B D                 Chicken  ======
  D            Mallard duck  ======
        Tibetan ground jay  ======
B D         Tasmanian devil  ======
B D           X. tropicalis  ======
  D           Scarlet macaw  ======
  D             Rock pigeon  ======
B D     Medium ground finch  ======
  D                  Parrot  ======
              Weddell seal  ------
B D                     Cat  ======
           Star-nosed mole  ======
             Big brown bat  ------
B D                     Dog  ======
          Black flying-fox  ======
      David's myotis (bat)  ======

Alignment block 20 of 324 in window, 136131013 - 136131017, 5 bps 
B D                   Human  cgggg
B D                   Chimp  cgggg
B D                 Gorilla  cgggg
B D                  Rhesus  cgggg
B D     Crab-eating macaque  cgggg
B D                  Baboon  cgggg
               Green monkey  c-ggg
B D                Marmoset  tgggg
         Chinese tree shrew  cgggg
     Lesser Egyptian jerboa  caggc
B D                   Horse  ctggg
B D        White rhinoceros  c-ggg
  D     Collared flycatcher  cgggg
B D             Zebra finch  ---cg
B D                    Pika  =====
              Prairie vole  =====
B D               Orangutan  =====
B D                Platypus  =====
B D                  Gibbon  NNNNN
B D                  Turkey  =====
B D                 Chicken  =====
  D            Mallard duck  =====
        Tibetan ground jay  =====
B D         Tasmanian devil  =====
B D               Zebrafish  -----
B D           X. tropicalis  =====
  D           Scarlet macaw  =====
B D              Budgerigar  -----
  D             Rock pigeon  =====
B D     Medium ground finch  =====
  D        Peregrine falcon  -----
  D            Saker falcon  -----
  D                  Parrot  =====
              Weddell seal  -----
B D                     Cat  =====
           Star-nosed mole  =====
             Big brown bat  -----
B D                     Dog  =====
          Black flying-fox  =====
      David's myotis (bat)  =====

Inserts between block 20 and 21 in window
  D    Collared flycatcher 1bp
B D            Zebra finch 1bp

Alignment block 21 of 324 in window, 136131018 - 136131018, 1 bps 
B D                   Human  c
B D                   Chimp  c
B D                 Gorilla  c
B D                  Rhesus  c
B D     Crab-eating macaque  c
B D                  Baboon  c
               Green monkey  c
B D                Marmoset  c
         Chinese tree shrew  t
     Lesser Egyptian jerboa  c
B D                   Horse  c
B D        White rhinoceros  c
B D                Platypus  c
  D     Collared flycatcher  c
B D             Zebra finch  c
B D                    Pika  =
              Prairie vole  =
B D               Orangutan  =
B D                  Gibbon  N
B D                  Turkey  =
B D                 Chicken  =
  D            Mallard duck  =
        Tibetan ground jay  =
B D         Tasmanian devil  =
B D               Zebrafish  -
B D           X. tropicalis  =
  D           Scarlet macaw  =
B D              Budgerigar  -
  D             Rock pigeon  =
B D     Medium ground finch  =
  D        Peregrine falcon  -
  D            Saker falcon  -
  D                  Parrot  =
              Weddell seal  -
B D                     Cat  =
           Star-nosed mole  =
             Big brown bat  -
B D                     Dog  =
          Black flying-fox  =
      David's myotis (bat)  =

Alignment block 22 of 324 in window, 136131019 - 136131024, 6 bps 
B D                   Human  -tgccgg
B D                   Chimp  -tgctgg
B D                 Gorilla  -tgctgg
B D                  Rhesus  -tgtcgg
B D     Crab-eating macaque  -tgtcgg
B D                  Baboon  -tgccgg
               Green monkey  -tgccgg
B D                Marmoset  -tgc---
         Chinese tree shrew  -ggcctg
     Lesser Egyptian jerboa  -agccgc
B D                 Ferret   -tgtcgg
               Weddell seal  --cgctc
B D                Platypus  -taacgt
  D     Collared flycatcher  -tcctgg
B D             Zebra finch  -tgctgg
B D               Zebrafish  ttcaca-
B D                    Pika  =======
              Prairie vole  =======
B D               Orangutan  =======
B D                  Gibbon  NNNNNNN
B D                  Turkey  =======
B D                 Chicken  =======
  D            Mallard duck  =======
        Tibetan ground jay  =======
B D         Tasmanian devil  =======
B D           X. tropicalis  =======
  D           Scarlet macaw  =======
B D              Budgerigar  -------
  D             Rock pigeon  =======
B D     Medium ground finch  =======
  D        Peregrine falcon  -------
  D            Saker falcon  -------
  D                  Parrot  =======
B D                     Cat  =======
           Star-nosed mole  =======
             Big brown bat  -------
B D                     Dog  =======
          Black flying-fox  =======
B D        White rhinoceros  -------
B D                   Horse  -------
      David's myotis (bat)  =======

Inserts between block 22 and 23 in window
    Lesser Egyptian jerboa 1bp

Alignment block 23 of 324 in window, 136131025 - 136131025, 1 bps 
B D                   Human  c
B D                   Chimp  c
B D                 Gorilla  c
B D                  Rhesus  c
B D     Crab-eating macaque  c
B D                  Baboon  c
               Green monkey  c
B D                Marmoset  c
         Chinese tree shrew  c
     Lesser Egyptian jerboa  c
B D                    Pika  c
B D                 Ferret   g
               Weddell seal  a
B D                Platypus  c
B D             Zebra finch  c
B D               Zebrafish  c
              Prairie vole  =
B D               Orangutan  =
B D                  Gibbon  N
B D                  Turkey  =
B D                 Chicken  =
  D            Mallard duck  =
        Tibetan ground jay  =
B D         Tasmanian devil  =
B D           X. tropicalis  =
  D           Scarlet macaw  =
B D              Budgerigar  -
  D             Rock pigeon  =
B D     Medium ground finch  =
  D        Peregrine falcon  -
  D            Saker falcon  -
  D                  Parrot  =
B D                     Cat  =
  D     Collared flycatcher  -
           Star-nosed mole  =
             Big brown bat  -
B D                     Dog  =
          Black flying-fox  =
B D        White rhinoceros  -
B D                   Horse  -
      David's myotis (bat)  =

Inserts between block 23 and 24 in window
B D               Platypus 2583bp
B D            Zebra finch 1bp

Alignment block 24 of 324 in window, 136131026 - 136131028, 3 bps 
B D                   Human  agc
B D                   Chimp  agc
B D                 Gorilla  agc
B D                  Rhesus  agc
B D     Crab-eating macaque  agc
B D                  Baboon  agc
               Green monkey  agc
B D                Marmoset  aac
         Chinese tree shrew  agc
     Lesser Egyptian jerboa  agc
B D                    Pika  agc
B D                   Horse  -gg
B D        White rhinoceros  -gg
B D                 Ferret   aga
               Weddell seal  agg
B D                Platypus  atc
  D     Collared flycatcher  ag-
B D             Zebra finch  ag-
B D               Zebrafish  agt
              Prairie vole  ===
B D               Orangutan  ===
B D                  Gibbon  NNN
B D                  Turkey  ===
B D                 Chicken  ===
  D            Mallard duck  ===
        Tibetan ground jay  ===
B D         Tasmanian devil  ===
B D           X. tropicalis  ===
  D           Scarlet macaw  ===
B D              Budgerigar  ---
  D             Rock pigeon  ===
B D     Medium ground finch  ===
  D        Peregrine falcon  ---
  D            Saker falcon  ---
  D                  Parrot  ===
B D                     Cat  ===
           Star-nosed mole  ===
             Big brown bat  ---
B D                     Dog  ===
          Black flying-fox  ===
      David's myotis (bat)  ===

Inserts between block 24 and 25 in window
  D    Collared flycatcher 9bp
B D            Zebra finch 9bp

Alignment block 25 of 324 in window, 136131029 - 136131033, 5 bps 
B D                   Human  cctcc-
B D                   Chimp  cctcc-
B D                 Gorilla  cttcc-
B D                  Rhesus  cctcc-
B D     Crab-eating macaque  cctcc-
B D                  Baboon  cctcc-
               Green monkey  cctcc-
B D                Marmoset  cctcc-
         Chinese tree shrew  tcggc-
     Lesser Egyptian jerboa  cactc-
B D                    Pika  caggg-
B D                   Horse  ccgcc-
B D        White rhinoceros  cctcc-
B D                 Ferret   catcc-
               Weddell seal  cagca-
B D                Platypus  ctttc-
  D            Saker falcon  c-----
  D        Peregrine falcon  c-----
  D     Collared flycatcher  c-----
B D             Zebra finch  c-----
B D              Budgerigar  c-----
  D         Green seaturtle  c-----
B D               Zebrafish  -cttca
              Prairie vole  ======
B D               Orangutan  ======
B D                  Gibbon  NNNNNN
B D                  Turkey  ======
B D                 Chicken  ======
  D            Mallard duck  ======
        Tibetan ground jay  ======
B D         Tasmanian devil  ======
B D           X. tropicalis  ======
  D           Scarlet macaw  ======
  D             Rock pigeon  ======
B D     Medium ground finch  ======
  D                  Parrot  ======
B D                     Cat  ======
           Star-nosed mole  ======
             Big brown bat  ------
B D                     Dog  ======
          Black flying-fox  ======
      David's myotis (bat)  ======

Inserts between block 25 and 26 in window
  D           Saker falcon 2bp
  D       Peregrine falcon 2bp
  D    Collared flycatcher 2bp
B D            Zebra finch 2bp
B D             Budgerigar 2bp
  D        Green seaturtle 8bp
B D              Zebrafish 1bp

Alignment block 26 of 324 in window, 136131034 - 136131037, 4 bps 
B D                   Human  caga
B D                   Chimp  caga
B D                 Gorilla  caga
B D                  Rhesus  caga
B D     Crab-eating macaque  caga
B D                  Baboon  caga
               Green monkey  caga
B D                Marmoset  caga
         Chinese tree shrew  ccg-
     Lesser Egyptian jerboa  ctga
B D                    Pika  cagt
B D                   Horse  cacg
B D        White rhinoceros  cgcg
B D                 Ferret   cggg
               Weddell seal  c---
B D                Platypus  caaa
B D            Atlantic cod  ca--
              Prairie vole  ====
B D               Orangutan  ====
B D                  Gibbon  NNNN
B D                  Turkey  ====
B D                 Chicken  ====
  D            Mallard duck  ====
        Tibetan ground jay  ====
B D             Zebra finch  ====
B D         Tasmanian devil  ====
B D               Zebrafish  ====
B D           X. tropicalis  ====
  D         Green seaturtle  ====
  D           Scarlet macaw  ====
B D              Budgerigar  ====
  D             Rock pigeon  ====
B D     Medium ground finch  ====
  D        Peregrine falcon  ====
  D            Saker falcon  ====
  D                  Parrot  ====
B D                     Cat  ====
  D     Collared flycatcher  ====
           Star-nosed mole  ====
             Big brown bat  ----
B D                     Dog  ====
          Black flying-fox  ====
      David's myotis (bat)  ====

Inserts between block 26 and 27 in window
B D           Atlantic cod 2bp

Alignment block 27 of 324 in window, 136131038 - 136131039, 2 bps 
B D                   Human  --g-----------c
B D                   Chimp  --g-----------c
B D                 Gorilla  --g-----------c
B D                  Rhesus  --g-----------c
B D     Crab-eating macaque  --g-----------c
B D                  Baboon  --g-----------c
               Green monkey  --g-----------c
B D                Marmoset  --g-----------c
     Lesser Egyptian jerboa  --g-----------a
B D                    Pika  --g-----------g
B D                   Horse  --cccttgcgcagtc
B D        White rhinoceros  --c-----------c
B D                 Ferret   --------------c
               Weddell seal  --------------c
B D                Platypus  --g------------
         Southern platyfish  -g-------------
B D            Atlantic cod  gc-------------
              Prairie vole  ===============
B D               Orangutan  ===============
B D                  Gibbon  NNNNNNNNNNNNNNN
B D                  Turkey  ===============
B D                 Chicken  ===============
  D            Mallard duck  ===============
        Tibetan ground jay  ===============
B D             Zebra finch  ===============
B D         Tasmanian devil  ===============
B D               Zebrafish  ===============
B D           X. tropicalis  ===============
  D         Green seaturtle  ===============
  D           Scarlet macaw  ===============
B D              Budgerigar  ===============
  D             Rock pigeon  ===============
B D     Medium ground finch  ===============
  D        Peregrine falcon  ===============
  D            Saker falcon  ===============
  D                  Parrot  ===============
        Chinese tree shrew  ---------------
B D                     Cat  ===============
  D     Collared flycatcher  ===============
           Star-nosed mole  ===============
             Big brown bat  ---------------
B D                     Dog  ===============
          Black flying-fox  ===============
      David's myotis (bat)  ===============

Alignment block 28 of 324 in window, 136131040 - 136131040, 1 bps 
B D                   Human  c
B D                   Chimp  c
B D                 Gorilla  c
B D                  Rhesus  c
B D     Crab-eating macaque  c
B D                  Baboon  c
               Green monkey  c
B D                Marmoset  c
     Lesser Egyptian jerboa  c
B D                    Pika  g
B D                   Horse  c
B D        White rhinoceros  c
B D                 Ferret   c
               Weddell seal  c
  D            Saker falcon  c
  D        Peregrine falcon  c
  D     Collared flycatcher  c
B D             Zebra finch  c
B D              Budgerigar  c
B D      American alligator  c
  D         Green seaturtle  c
         Southern platyfish  c
B D            Atlantic cod  t
              Prairie vole  =
B D               Orangutan  =
B D                Platypus  -
B D                  Gibbon  N
B D                  Turkey  =
B D                 Chicken  =
  D            Mallard duck  =
        Tibetan ground jay  =
B D         Tasmanian devil  =
B D               Zebrafish  =
B D           X. tropicalis  =
  D           Scarlet macaw  =
  D             Rock pigeon  =
B D     Medium ground finch  =
  D                  Parrot  =
        Chinese tree shrew  -
B D                     Cat  =
           Star-nosed mole  =
             Big brown bat  -
B D                     Dog  =
          Black flying-fox  =
      David's myotis (bat)  =

Alignment block 29 of 324 in window, 136131041 - 136131045, 5 bps 
B D                   Human  cctgg
B D                   Chimp  cctgg
B D                 Gorilla  cctgg
B D                  Rhesus  cctgg
B D     Crab-eating macaque  cctgg
B D                  Baboon  cctgg
               Green monkey  cctgg
     Lesser Egyptian jerboa  cctgg
B D                    Pika  c--ag
              Domestic goat  cttgg
B D                   Horse  tcctg
B D        White rhinoceros  tccgc
B D                 Ferret   cccgg
               Weddell seal  tctga
B D                Platypus  ---g-
  D            Saker falcon  tctg-
  D        Peregrine falcon  tctg-
  D     Collared flycatcher  atag-
B D             Zebra finch  tggg-
B D              Budgerigar  tctg-
B D      American alligator  tcc--
  D         Green seaturtle  tga--
         Southern platyfish  ccagt
B D            Atlantic cod  cctgt
              Prairie vole  =====
B D               Orangutan  =====
B D                  Gibbon  NNNNN
B D                  Turkey  =====
B D                 Chicken  =====
  D            Mallard duck  =====
        Tibetan ground jay  =====
B D         Tasmanian devil  =====
B D               Zebrafish  =====
B D           X. tropicalis  =====
  D           Scarlet macaw  =====
  D             Rock pigeon  =====
B D     Medium ground finch  =====
  D                  Parrot  =====
        Chinese tree shrew  -----
B D                     Cat  =====
           Star-nosed mole  =====
             Big brown bat  -----
B D                Marmoset  -----
B D                     Dog  =====
          Black flying-fox  =====
      David's myotis (bat)  =====

Inserts between block 29 and 30 in window
B D                  Horse 1bp
B D       White rhinoceros 1bp
B D                Ferret  1bp
              Weddell seal 1658bp
B D     American alligator 11bp
  D        Green seaturtle 5bp

Alignment block 30 of 324 in window, 136131046 - 136131047, 2 bps 
B D                   Human  ca-
B D                   Chimp  ca-
B D                 Gorilla  ca-
B D                  Rhesus  ca-
B D     Crab-eating macaque  ca-
B D                  Baboon  ca-
               Green monkey  ca-
B D                Marmoset  ca-
     Lesser Egyptian jerboa  ct-
B D                    Pika  gt-
              Domestic goat  ca-
B D                   Horse  ca-
B D        White rhinoceros  ca-
               Weddell seal  ca-
B D                Platypus  -a-
  D            Saker falcon  ca-
  D        Peregrine falcon  ca-
  D     Collared flycatcher  ca-
B D             Zebra finch  ca-
B D              Budgerigar  ca-
  D            Mallard duck  tg-
B D                 Chicken  ca-
B D      American alligator  ca-
  D         Green seaturtle  ca-
         Southern platyfish  -ac
B D            Atlantic cod  -ct
              Prairie vole  ===
B D               Orangutan  ===
B D                  Gibbon  NNN
B D                  Turkey  ===
        Tibetan ground jay  ===
B D         Tasmanian devil  ===
B D               Zebrafish  ===
B D           X. tropicalis  ===
  D           Scarlet macaw  ===
  D             Rock pigeon  ===
B D     Medium ground finch  ===
  D                  Parrot  ===
        Chinese tree shrew  ---
B D                     Cat  ===
B D                 Ferret   ===
           Star-nosed mole  ===
             Big brown bat  ---
B D                     Dog  ===
          Black flying-fox  ===
      David's myotis (bat)  ===

Inserts between block 30 and 31 in window
B D               Platypus 2bp

Alignment block 31 of 324 in window, 136131048 - 136131051, 4 bps 
B D                   Human  gccg-
B D                   Chimp  gccg-
B D                 Gorilla  gccg-
B D                  Rhesus  gctg-
B D     Crab-eating macaque  gctg-
B D                  Baboon  gccg-
               Green monkey  gccg-
B D                Marmoset  cccg-
     Lesser Egyptian jerboa  atca-
B D                    Pika  gtca-
              Domestic goat  acta-
B D                   Horse  gccc-
B D        White rhinoceros  gccc-
B D                     Dog  gccc-
B D                 Ferret   --tc-
               Weddell seal  gccc-
B D                Platypus  gtt--
  D            Saker falcon  g----
  D        Peregrine falcon  g----
  D     Collared flycatcher  g----
B D             Zebra finch  g----
B D              Budgerigar  g----
  D            Mallard duck  a----
B D                 Chicken  g----
B D      American alligator  g----
  D         Green seaturtle  g----
         Southern platyfish  -ttca
B D            Atlantic cod  -ccca
B D               Zebrafish  -ttaa
              Prairie vole  =====
B D               Orangutan  =====
B D                  Gibbon  NNNNN
B D                  Turkey  =====
        Tibetan ground jay  =====
B D         Tasmanian devil  =====
B D           X. tropicalis  =====
  D           Scarlet macaw  =====
  D             Rock pigeon  =====
B D     Medium ground finch  =====
  D                  Parrot  =====
        Chinese tree shrew  -----
B D                     Cat  =====
           Star-nosed mole  =====
             Big brown bat  -----
          Black flying-fox  =====
      David's myotis (bat)  =====

Inserts between block 31 and 32 in window
             Domestic goat 4bp
  D    Collared flycatcher 3bp
  D           Mallard duck 5bp
B D                Chicken 8bp
        Southern platyfish 1bp
B D              Zebrafish 5bp

Alignment block 32 of 324 in window, 136131052 - 136131052, 1 bps 
B D                   Human  c
B D                   Chimp  c
B D                 Gorilla  c
B D                  Rhesus  c
B D     Crab-eating macaque  c
B D                  Baboon  c
               Green monkey  c
B D                Marmoset  c
B D                    Pika  c
B D                     Cow  c
B D                   Sheep  c
              Domestic goat  c
B D                   Horse  g
B D        White rhinoceros  c
B D                     Dog  c
B D                 Ferret   c
               Weddell seal  c
B D                Platypus  c
B D             Stickleback  c
    Lesser Egyptian jerboa  -
              Prairie vole  =
B D               Orangutan  =
B D            Atlantic cod  -
B D                  Gibbon  N
        Southern platyfish  =
B D                  Turkey  =
B D                 Chicken  =
  D            Mallard duck  =
        Tibetan ground jay  =
B D             Zebra finch  -
B D         Tasmanian devil  =
B D               Zebrafish  =
B D           X. tropicalis  =
  D         Green seaturtle  -
B D      American alligator  -
  D           Scarlet macaw  =
B D              Budgerigar  -
  D             Rock pigeon  =
B D     Medium ground finch  =
  D        Peregrine falcon  -
  D            Saker falcon  -
  D                  Parrot  =
        Chinese tree shrew  -
B D                     Cat  =
  D     Collared flycatcher  =
           Star-nosed mole  =
             Big brown bat  -
          Black flying-fox  =
      David's myotis (bat)  =

Alignment block 33 of 324 in window, 136131053 - 136131053, 1 bps 
B D                   Human  t
B D                   Chimp  t
B D                 Gorilla  t
B D                  Rhesus  t
B D     Crab-eating macaque  t
B D                  Baboon  t
               Green monkey  t
B D                Marmoset  t
B D                    Pika  g
B D                     Cow  t
B D                   Sheep  t
              Domestic goat  t
B D                   Horse  t
B D        White rhinoceros  t
B D                     Dog  t
B D                 Ferret   t
               Weddell seal  t
              Big brown bat  c
B D                 Opossum  t
B D                Platypus  t
B D             Stickleback  t
    Lesser Egyptian jerboa  -
              Prairie vole  =
B D               Orangutan  =
B D            Atlantic cod  -
B D                  Gibbon  N
        Southern platyfish  =
B D                  Turkey  =
B D                 Chicken  =
  D            Mallard duck  =
        Tibetan ground jay  =
B D             Zebra finch  -
B D         Tasmanian devil  =
B D               Zebrafish  =
B D           X. tropicalis  =
  D         Green seaturtle  -
B D      American alligator  -
  D           Scarlet macaw  =
B D              Budgerigar  -
  D             Rock pigeon  =
B D     Medium ground finch  =
  D        Peregrine falcon  -
  D            Saker falcon  -
  D                  Parrot  =
        Chinese tree shrew  -
B D                     Cat  =
  D     Collared flycatcher  =
           Star-nosed mole  =
          Black flying-fox  =
      David's myotis (bat)  =

Alignment block 34 of 324 in window, 136131054 - 136131057, 4 bps 
B D                   Human  --cacg
B D                   Chimp  --cacg
B D                 Gorilla  --cacg
B D                  Rhesus  --cacg
B D     Crab-eating macaque  --cacg
B D                  Baboon  --cacg
               Green monkey  --cacg
B D                Marmoset  --catg
         Chinese tree shrew  -----g
B D                     Cow  --catc
B D                   Sheep  --catc
              Domestic goat  --catc
B D                   Horse  --catc
B D        White rhinoceros  --catc
B D                     Dog  --cagg
B D                 Ferret   --c---
               Weddell seal  --tacg
              Big brown bat  --cgtc
B D                 Opossum  --tact
B D                Platypus  --catc
B D           X. tropicalis  --catt
         Southern platyfish  ctca--
B D             Stickleback  ctca--
B D            Atlantic cod  ttta--
B D               Zebrafish  ttta--
    Lesser Egyptian jerboa  ------
B D                    Pika  ------
              Prairie vole  ======
B D               Orangutan  ======
B D                  Gibbon  NNNNNN
B D                  Turkey  ======
B D                 Chicken  ======
  D            Mallard duck  ======
        Tibetan ground jay  ======
B D             Zebra finch  ------
B D         Tasmanian devil  ======
  D         Green seaturtle  ------
B D      American alligator  ------
  D           Scarlet macaw  ======
B D              Budgerigar  ------
  D             Rock pigeon  ======
B D     Medium ground finch  ======
  D        Peregrine falcon  ------
  D            Saker falcon  ------
  D                  Parrot  ======
B D                     Cat  ======
  D     Collared flycatcher  ======
           Star-nosed mole  ======
          Black flying-fox  ======
      David's myotis (bat)  ======

Alignment block 35 of 324 in window, 136131058 - 136131059, 2 bps 
B D                   Human  gg-
B D                   Chimp  gg-
B D                 Gorilla  gg-
B D                  Rhesus  gg-
B D     Crab-eating macaque  gg-
B D                  Baboon  gg-
               Green monkey  gg-
B D                Marmoset  gg-
         Chinese tree shrew  tg-
     Lesser Egyptian jerboa  -g-
               Prairie vole  gg-
B D                    Pika  gg-
B D                     Cow  gg-
B D                   Sheep  gg-
              Domestic goat  gg-
B D                   Horse  gg-
B D        White rhinoceros  gg-
B D                     Dog  ag-
B D                 Ferret   ag-
               Weddell seal  ag-
              Big brown bat  ag-
B D                 Opossum  tg-
B D                Platypus  tg-
B D           X. tropicalis  ag-
         Southern platyfish  -g-
B D             Stickleback  -gg
B D            Atlantic cod  -ga
B D               Zebrafish  -tg
B D               Orangutan  ===
B D                  Gibbon  NNN
B D                  Turkey  ===
B D                 Chicken  ===
  D            Mallard duck  ===
        Tibetan ground jay  ===
B D             Zebra finch  ---
B D         Tasmanian devil  ===
  D         Green seaturtle  ---
B D      American alligator  ---
  D           Scarlet macaw  ===
B D              Budgerigar  ---
  D             Rock pigeon  ===
B D     Medium ground finch  ===
  D        Peregrine falcon  ---
  D            Saker falcon  ---
  D                  Parrot  ===
B D                     Cat  ===
  D     Collared flycatcher  ===
           Star-nosed mole  ===
          Black flying-fox  ===
      David's myotis (bat)  ===

Alignment block 36 of 324 in window, 136131060 - 136131070, 11 bps 
B D                     Human  ttccggaccgc
B D                     Chimp  ttccggaccgc
B D                   Gorilla  ttccggaccgc
B D                    Rhesus  ttccggaccgc
B D       Crab-eating macaque  ttccggaccgc
B D                    Baboon  ttccggaccgc
                 Green monkey  ttccggactgc
B D                  Marmoset  ttccggattgc
           Chinese tree shrew  gtgcagctttc
       Lesser Egyptian jerboa  ttccggattgc
                 Prairie vole  ttcctgattgc
B D                      Pika  ttccggatggc
B D                       Cow  ctccgaatctc
B D                     Sheep  ttccgaatctc
                Domestic goat  ttccgaatctc
B D                     Horse  ttccggatctc
B D          White rhinoceros  ttccggatggc
B D                       Dog  ccccggatgtc
B D                   Ferret   tggcggatttc
                 Weddell seal  tcccggatgtc
                Big brown bat  ctccgcagcca
B D                   Opossum  ttccgaatctt
B D                  Platypus  tttcgaatttc
  D              Saker falcon  ----ggatcag
  D          Peregrine falcon  ----ggatcag
  D       Collared flycatcher  ----gaagcta
B D               Zebra finch  ----gaagcaa
B D                Budgerigar  ----ggatcag
  D               Rock pigeon  tctcgtatctc
  D              Mallard duck  cttcatatctc
B D                   Chicken  tttcttacctc
B D        American alligator  -tcagaaccca
  D           Green seaturtle  tcccgtatctc
B D            Painted turtle  tttctgattgc
  D  Chinese softshell turtle  tttctgattgc
  D    Spiny softshell turtle  tttctgattgc
B D             X. tropicalis  ttacggatggc
B D                Coelacanth  tcccttactgc
           Southern platyfish  --ttgggtcgt
B D               Stickleback  cattgggtcgg
B D              Atlantic cod  cattggggcgc
B D                 Zebrafish  tgtttggacga
B D                 Orangutan  ===========
B D                    Gibbon  NNNNNNNNNNN
B D                    Turkey  ===========
          Tibetan ground jay  ===========
B D           Tasmanian devil  ===========
  D             Scarlet macaw  ===========
B D       Medium ground finch  ===========
  D                    Parrot  ===========
B D                       Cat  ===========
             Star-nosed mole  ===========
            Black flying-fox  ===========
        David's myotis (bat)  ===========

Inserts between block 36 and 37 in window
  D             Saker falcon 19bp
  D         Peregrine falcon 19bp
  D      Collared flycatcher 29bp
B D              Zebra finch 758bp
B D               Budgerigar 19bp
B D       American alligator 5bp

Alignment block 37 of 324 in window, 136131071 - 136131073, 3 bps 
B D                     Human  -ctg
B D                     Chimp  -ctg
B D                   Gorilla  -ctg
B D                    Rhesus  -ctg
B D       Crab-eating macaque  -ctg
B D                    Baboon  -ctg
                 Green monkey  -ctg
B D                  Marmoset  -ctg
           Chinese tree shrew  -ctg
       Lesser Egyptian jerboa  -ctc
                 Prairie vole  -ctg
B D                      Pika  -ctg
B D                       Cow  -tgt
B D                     Sheep  -tcc
                Domestic goat  -tcc
B D                     Horse  -ccg
B D          White rhinoceros  -gcg
B D                       Dog  -cag
B D                   Ferret   -ggc
                 Weddell seal  -tcg
                Big brown bat  -gcg
B D                   Opossum  -agc
B D                  Platypus  -ggc
  D              Saker falcon  -ttt
  D          Peregrine falcon  -ttt
  D       Collared flycatcher  -ctg
  D    White-throated sparrow  -ctg
B D       Medium ground finch  -ctg
B D               Zebra finch  -ctg
B D                Budgerigar  -att
  D               Rock pigeon  -ttt
  D              Mallard duck  -ttt
B D                   Chicken  -ctg
B D        American alligator  -ttt
  D           Green seaturtle  -ctt
B D            Painted turtle  -agc
  D  Chinese softshell turtle  -agt
  D    Spiny softshell turtle  -agc
B D             X. tropicalis  -ctc
B D                Coelacanth  -ctt
           Southern platyfish  att-
B D               Stickleback  atg-
B D              Atlantic cod  agt-
B D                 Zebrafish  act-
B D                 Orangutan  ====
B D                    Gibbon  NNNN
B D                    Turkey  ====
          Tibetan ground jay  ====
B D           Tasmanian devil  ====
  D             Scarlet macaw  ====
  D                    Parrot  ====
B D                       Cat  ====
             Star-nosed mole  ====
            Black flying-fox  ====
        David's myotis (bat)  ====

Inserts between block 37 and 38 in window
          Southern platyfish 5bp
B D              Stickleback 5bp
B D             Atlantic cod 5bp
B D                Zebrafish 5bp

Alignment block 38 of 324 in window, 136131074 - 136131088, 15 bps 
B D                     Human  gtggttctt---gggca------c
B D                     Chimp  gtggttctt---gggca------c
B D                   Gorilla  gtggttctt---gggca------c
B D                    Rhesus  gtggttctt---gggca------c
B D       Crab-eating macaque  gtggttctt---gggca------c
B D                    Baboon  gtggttctt---gggca------c
                 Green monkey  gtggttctt---gggca------c
B D                  Marmoset  gtggttctt---gggca------c
           Chinese tree shrew  ggggtcctg---gggca------g
       Lesser Egyptian jerboa  gtggttctt---gggca------c
                 Prairie vole  atggttctt---gggca------c
B D                      Pika  gtgattctt---gggca------c
B D                       Cow  atggttcat---gggca------c
B D                     Sheep  gtggttctt---gggca------c
                Domestic goat  gtggttctt---gggca------c
B D                     Horse  gtgattctt---gggca------c
B D          White rhinoceros  gtgattctt---gggca------c
B D                       Dog  gtgaccctt---gggca------c
B D                   Ferret   gtgattctt---gggca------c
                 Weddell seal  gtgattctt---gggca------c
                Big brown bat  ggtgttcttgtcgagcg------t
B D                   Opossum  atggttctt---tggca------c
B D                  Platypus  atggttctt---aggca------c
  D              Saker falcon  gtagttctt---atcca-c-----
  D          Peregrine falcon  gtagttctt---atcca-c-----
  D       Collared flycatcher  gctgtccct---gtgca-------
  D    White-throated sparrow  gccatgctg---gtgca-------
B D       Medium ground finch  gctgtgctg---gtgca-------
B D               Zebra finch  gctgtgctg---gtgca-------
B D                Budgerigar  gtagttctt---atccac------
  D               Rock pigeon  gtagttctt---atcca--c----
  D              Mallard duck  gtagttctt---atcca---c---
B D                   Chicken  gtagttctt---atcta---c---
B D        American alligator  aaggttctt---gcaca----c--
  D           Green seaturtle  gtagtcctt---atcca-----c-
B D            Painted turtle  atggttctt---tggta-----c-
  D  Chinese softshell turtle  atggttctt---tggta-----c-
  D    Spiny softshell turtle  atggttgtt---tggta-----c-
B D             X. tropicalis  gtggttttt---tggaa------c
B D                Coelacanth  gtgattttt---cggca------c
B D                      Fugu  gtagtcttt---gggcg------c
B D              Nile tilapia  gtagttctt---gatga------c
           Southern platyfish  gtagttctt---tatga------c
B D               Stickleback  atagttctt---gacaa------c
B D              Atlantic cod  gtaattctt---tggcg------c
B D                 Zebrafish  atagttttt---aggaa------c
B D                 Orangutan  ========================
B D                    Gibbon  NNNNNNNNNNNNNNNNNNNNNNNN
B D                    Turkey  ========================
          Tibetan ground jay  ========================
B D           Tasmanian devil  ========================
  D             Scarlet macaw  ========================
  D                    Parrot  ========================
B D                       Cat  ========================
             Star-nosed mole  ========================
            Black flying-fox  ========================
        David's myotis (bat)  ========================

Alignment block 39 of 324 in window, 136131089 - 136131113, 25 bps 
B D                     Human  cgcagtgaacctcagcttcctcagg
B D                     Chimp  cgcagtgaacctcagcttcctcagg
B D                   Gorilla  cgcagtgaacctcagcttcctcagg
B D                    Rhesus  cgccacgaacctcagcttcctcagg
B D       Crab-eating macaque  cgccacgaacctcagcttcctcagg
B D                    Baboon  cgccgcgaacctcagcttcctcagg
                 Green monkey  cgccgcgaacctcagcttcctcagg
B D                  Marmoset  cgccacaaacctcagcttcttcagg
           Chinese tree shrew  ggccacagatcttggcttcgt---g
       Lesser Egyptian jerboa  ggccacatatcgcagcttcttcatg
                 Prairie vole  agtcacatatctcagcttcttcatg
B D                      Pika  agccacaaaccgcagcttcttcatg
B D                       Cow  agccacgtagcgcagcttccggagt
B D                     Sheep  ggccacgtagcgcagcttccggagt
                Domestic goat  ggccacgtagcgcagcttccggagt
B D                     Horse  agccacgtatctcagcttcctcatg
B D          White rhinoceros  ggccacgtatctcagcttcctcagg
B D                       Dog  agccacgaatctcagcttcttcatg
B D                   Ferret   cgccacgtagcgcagtctcttgagg
                 Weddell seal  ggccacgaatctcagcttcgtcatg
                Big brown bat  agagaagcggatcagct---tgagg
B D                   Opossum  agccaacatcctcattttcctgagg
B D                  Platypus  ggccacatacctcaatttctgaagg
  D              Saker falcon  ------tgtggaaaaacgtatgagg
  D          Peregrine falcon  ------tgtggaaaaacgtatgagg
  D       Collared flycatcher  -----cagagcacatcctcttcacg
  D    White-throated sparrow  -----cagggcacatcctcttcacc
B D       Medium ground finch  -----cagggcacatcctcttcacc
B D               Zebra finch  -----cagggcacatcctcttcacc
           Tibetan ground jay  ---cactgggcacatcctcttcacc
B D                Budgerigar  ------tgtggaaaaacacttgagg
  D               Rock pigeon  ------tgtggagaaacgtatgagg
  D              Mallard duck  ------tgtggagaagcgtatgagg
B D                   Chicken  ------tgtggaaaagcgtatgagg
B D        American alligator  ------agatgataacctcttcacc
  D           Green seaturtle  ------cgtggagaagcgtatcagg
B D            Painted turtle  ------agcaagaaaccttctt---
  D  Chinese softshell turtle  ------agcaagaaacctcctt---
  D    Spiny softshell turtle  ------agcaagaaacctcctt---
B D             X. tropicalis  ggcgacaaatctcctcctttttagg
B D                Coelacanth  tgttgcaaatcgtgccaatttgagt
B D                      Fugu  -ccagaggagtcgg-----------
B D              Nile tilapia  -cccggagaacctg-----------
           Southern platyfish  -cccagagaatctg-----------
B D               Stickleback  -tccggagaacctg-----------
B D              Atlantic cod  -ccagagtagcctg-----------
B D                 Zebrafish  -ttgagaaaatcta-----------
B D                 Orangutan  =========================
B D                    Gibbon  NNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Turkey  =========================
B D           Tasmanian devil  =========================
  D             Scarlet macaw  =========================
  D                    Parrot  =========================
B D                       Cat  =========================
             Star-nosed mole  =========================
            Black flying-fox  =========================
        David's myotis (bat)  =========================

Inserts between block 39 and 40 in window
  D             Saker falcon 3bp
  D         Peregrine falcon 3bp
  D      Collared flycatcher 3bp
  D   White-throated sparrow 3bp
B D      Medium ground finch 3bp
B D              Zebra finch 3bp
          Tibetan ground jay 3bp
B D               Budgerigar 3bp
  D              Rock pigeon 3bp
  D             Mallard duck 3bp
B D                  Chicken 3bp
B D       American alligator 3bp
  D          Green seaturtle 2bp
B D            X. tropicalis 2bp

Alignment block 40 of 324 in window, 136131114 - 136131119, 6 bps 
B D                     Human  ---acggcg
B D                     Chimp  ---acggag
B D                   Gorilla  ---acggtg
B D                    Rhesus  ---accgcg
B D       Crab-eating macaque  ---accgcg
B D                    Baboon  ---accgca
                 Green monkey  ---accgca
B D                  Marmoset  ---aggggg
           Chinese tree shrew  ---accag-
       Lesser Egyptian jerboa  ---acggag
                 Prairie vole  ---atggag
B D                      Pika  ---actggc
B D                       Cow  ---aacggc
B D                     Sheep  ---aagggt
                Domestic goat  ---aagggc
B D                     Horse  ---atggcg
B D                       Dog  ---acgggg
B D                   Ferret   ---aaaggc
                 Weddell seal  ---acctgg
                Big brown bat  ---ctgggg
B D                   Opossum  ---aaggct
B D                  Platypus  ---atggcc
  D              Saker falcon  ---atttca
  D          Peregrine falcon  ---atttca
  D       Collared flycatcher  ---atgacg
  D    White-throated sparrow  ---atgctg
B D       Medium ground finch  ---atgctg
B D               Zebra finch  ---atggtg
           Tibetan ground jay  ---atgctg
B D                Budgerigar  ---atttca
  D               Rock pigeon  ---atttca
  D              Mallard duck  ---atttca
B D                   Chicken  ---atttcc
B D        American alligator  ---attatg
  D           Green seaturtle  ---cacttc
B D            Painted turtle  ---ttctta
  D  Chinese softshell turtle  ---ttccta
  D    Spiny softshell turtle  ---ttccta
B D             X. tropicalis  ---atcg--
B D                Coelacanth  ----tcagg
B D                      Fugu  gaaatg---
B D              Nile tilapia  atgatt---
           Southern platyfish  attacg---
B D               Stickleback  acaatg---
B D              Atlantic cod  gccaca---
B D                 Zebrafish  accatt---
B D                 Orangutan  =========
B D                    Gibbon  NNNNNNNNN
B D                    Turkey  =========
B D           Tasmanian devil  =========
  D             Scarlet macaw  =========
  D                    Parrot  =========
B D                       Cat  =========
             Star-nosed mole  =========
            Black flying-fox  =========
B D          White rhinoceros  ---------
        David's myotis (bat)  =========

Inserts between block 40 and 41 in window
B D            X. tropicalis 1bp
B D               Coelacanth 6bp

Alignment block 41 of 324 in window, 136131120 - 136131120, 1 bps 
B D                     Human  -g
B D                     Chimp  -g
B D                   Gorilla  -g
B D                    Rhesus  -g
B D       Crab-eating macaque  -g
B D                    Baboon  -g
                 Green monkey  -g
B D                  Marmoset  -g
           Chinese tree shrew  -g
       Lesser Egyptian jerboa  -g
                 Prairie vole  -g
B D                      Pika  -g
B D                       Cow  -g
B D                     Sheep  -g
                Domestic goat  -g
B D                     Horse  -g
B D                       Dog  -g
B D                   Ferret   -g
                 Weddell seal  -g
                Big brown bat  -g
B D                   Opossum  -g
B D                  Platypus  -g
  D              Saker falcon  -g
  D          Peregrine falcon  -g
  D       Collared flycatcher  -c
  D    White-throated sparrow  -c
B D       Medium ground finch  -c
B D               Zebra finch  -c
           Tibetan ground jay  -c
B D                Budgerigar  -g
  D               Rock pigeon  -g
  D              Mallard duck  -g
B D                   Chicken  -g
B D        American alligator  -g
  D           Green seaturtle  -a
B D            Painted turtle  -a
  D  Chinese softshell turtle  -a
  D    Spiny softshell turtle  -a
B D             X. tropicalis  -g
B D                Coelacanth  -g
B D                      Fugu  t-
B D              Nile tilapia  t-
           Southern platyfish  a-
B D               Stickleback  t-
B D              Atlantic cod  c-
B D                 Zebrafish  t-
B D                 Orangutan  ==
B D                    Gibbon  NN
B D                    Turkey  ==
B D           Tasmanian devil  ==
  D             Scarlet macaw  ==
  D                    Parrot  ==
B D                       Cat  ==
             Star-nosed mole  ==
            Black flying-fox  ==
B D          White rhinoceros  --
        David's myotis (bat)  ==

Inserts between block 41 and 42 in window
B D                     Fugu 7bp
B D             Nile tilapia 13bp
          Southern platyfish 13bp
B D              Stickleback 21bp
B D             Atlantic cod 11bp
B D                Zebrafish 11bp

Alignment block 42 of 324 in window, 136131121 - 136131131, 11 bps 
B D                     Human  gcca---gcccagc-----
B D                     Chimp  gcca---gcccagc-----
B D                   Gorilla  gcca---gcccagc-----
B D                    Rhesus  gcca---gcccagc-----
B D       Crab-eating macaque  gcca---gcccagc-----
B D                    Baboon  gcca---gcccagc-----
                 Green monkey  gcca---gcccagc-----
B D                  Marmoset  gcca---gcccagc-----
           Chinese tree shrew  gccg---gcctggc-----
       Lesser Egyptian jerboa  gcca---gcccagc-----
                 Prairie vole  gcca---gcccaga-----
B D                      Pika  gcca---gcccagc-----
B D                       Cow  gcct---ctgcagc-----
B D                     Sheep  gcct---ctgcagc-----
                Domestic goat  gcct---ctgcagc-----
B D                     Horse  gcca---gcccagc-----
B D                       Dog  gcca---gcccagc-----
B D                   Ferret   gcct---ctgcagc-----
                 Weddell seal  gcca---gcccagc-----
                Big brown bat  gccg---g---ggc-----
B D                   Opossum  gcca---ccctaag-----
B D                  Platypus  gcct---tcccaga-----
  D              Saker falcon  gggg---ttttgg------
  D          Peregrine falcon  gggg---ttttgg------
  D       Collared flycatcher  tggg---gctcagc-----
  D    White-throated sparrow  tgga---gctcagc-----
B D       Medium ground finch  tgga---gctcagc-----
B D               Zebra finch  tggg---gctgagc-----
           Tibetan ground jay  tggg---gctcagc-----
B D                Budgerigar  gggg---ctttggc-----
  D               Rock pigeon  gggg---ctttggc-----
  D              Mallard duck  gggg---ctttggc-----
B D                   Chicken  gggg---ctttggc-----
B D        American alligator  aaggaatctgcagc-----
  D           Green seaturtle  ggcg---gcttggg-----
B D            Painted turtle  ggat---ctctggc-----
  D  Chinese softshell turtle  ggat---ctctggc-----
  D    Spiny softshell turtle  ggat---ctgtggc-----
B D             X. tropicalis  gact---ccgaaac-----
B D                Coelacanth  ggtg---cttgatc-----
B D                      Fugu  --------t---gtcctgt
       Yellowbelly pufferfish  --------t---gtcctgt
B D              Nile tilapia  --------tttgggtttga
           Southern platyfish  --------tctggctttg-
B D               Stickleback  --------tgaagtcctgc
B D              Atlantic cod  -------------ttctgg
B D                 Zebrafish  ---------ggtgtccct-
B D                 Orangutan  ===================
B D                    Gibbon  NNNNNNNNNNNNNNNNNNN
B D                    Turkey  ===================
B D           Tasmanian devil  ===================
  D             Scarlet macaw  ===================
  D                    Parrot  ===================
B D                       Cat  ===================
             Star-nosed mole  ===================
            Black flying-fox  ===================
B D          White rhinoceros  -------------------
        David's myotis (bat)  ===================

Inserts between block 42 and 43 in window
  D             Saker falcon 10bp
  D         Peregrine falcon 10bp
          Southern platyfish 2bp
B D             Atlantic cod 5bp

Alignment block 43 of 324 in window, 136131132 - 136131138, 7 bps 
B D                     Human  agctgct----
B D                     Chimp  agctgct----
B D                   Gorilla  agctgct----
B D                    Rhesus  agctgct----
B D       Crab-eating macaque  agctgct----
B D                    Baboon  agctgct----
                 Green monkey  agctgct----
B D                  Marmoset  agttgct----
           Chinese tree shrew  agcggct----
       Lesser Egyptian jerboa  agctgct----
                 Prairie vole  agctgct----
B D                      Pika  agccgct----
B D                       Cow  atctgct----
B D                     Sheep  atctgct----
                Domestic goat  atccgct----
B D                     Horse  agcttct----
B D                       Dog  ttctgtc----
B D                   Ferret   atctgtt----
                 Weddell seal  agctgcg----
                Big brown bat  ttcctgt----
B D                   Opossum  agttgtt----
B D                  Platypus  agttgct----
  D       Collared flycatcher  tctg-------
  D    White-throated sparrow  tctg-------
B D       Medium ground finch  tctg-------
B D               Zebra finch  tcgg-------
           Tibetan ground jay  tccg-------
B D                Budgerigar  ttcc-------
  D               Rock pigeon  ttcc-------
  D              Mallard duck  ttcc-------
B D                   Chicken  ttcc-------
B D        American alligator  tcct-------
  D           Green seaturtle  ct---------
B D            Painted turtle  ctac-------
  D  Chinese softshell turtle  ctac-------
  D    Spiny softshell turtle  ctac-------
B D             X. tropicalis  tgttg------
B D                Coelacanth  g----------
B D                      Fugu  ----agccgat
       Yellowbelly pufferfish  ----agccgat
B D              Nile tilapia  ----agt----
B D                    Medaka  ---------at
           Southern platyfish  ---------at
B D              Atlantic cod  --------gac
B D                 Zebrafish  ----cttttat
B D                 Orangutan  ===========
B D                    Gibbon  NNNNNNNNNNN
B D               Stickleback  -----------
B D                    Turkey  ===========
B D           Tasmanian devil  ===========
  D             Scarlet macaw  ===========
  D          Peregrine falcon  ===========
  D              Saker falcon  ===========
  D                    Parrot  ===========
B D                       Cat  ===========
             Star-nosed mole  ===========
            Black flying-fox  ===========
B D          White rhinoceros  -----------
        David's myotis (bat)  ===========

Inserts between block 43 and 44 in window
  D      Collared flycatcher 2bp
  D   White-throated sparrow 2bp
B D      Medium ground finch 2bp
B D              Zebra finch 2bp
          Tibetan ground jay 2bp
B D               Budgerigar 5bp
  D              Rock pigeon 5bp
  D             Mallard duck 5bp
B D                  Chicken 5bp
B D       American alligator 2bp
  D          Green seaturtle 8bp
B D           Painted turtle 11bp
  D Chinese softshell turtle 11bp
  D   Spiny softshell turtle 11bp
B D                     Fugu 5bp
      Yellowbelly pufferfish 5bp
B D             Nile tilapia 2bp
B D                   Medaka 5bp
          Southern platyfish 2bp
B D             Atlantic cod 2bp
B D                Zebrafish 1bp

Alignment block 44 of 324 in window, 136131139 - 136131140, 2 bps 
B D                     Human  gg
B D                     Chimp  gg
B D                   Gorilla  gg
B D                    Rhesus  gg
B D       Crab-eating macaque  gg
B D                    Baboon  gg
                 Green monkey  gg
B D                  Marmoset  gg
           Chinese tree shrew  ca
       Lesser Egyptian jerboa  gg
                 Prairie vole  gg
B D                      Pika  cg
B D                       Cow  cg
B D                     Sheep  cg
                Domestic goat  cg
B D                     Horse  cg
B D                       Dog  gg
B D                   Ferret   cg
                 Weddell seal  gg
                Big brown bat  cg
B D                   Opossum  ta
B D                  Platypus  ca
B D                 Tetraodon  gg
B D                      Fugu  gg
       Yellowbelly pufferfish  gg
B D                    Medaka  gg
           Southern platyfish  tg
B D              Atlantic cod  gg
B D                 Zebrafish  a-
B D                 Orangutan  ==
B D                Coelacanth  --
B D                    Gibbon  NN
B D               Stickleback  --
B D                    Turkey  ==
B D                   Chicken  ==
  D              Mallard duck  ==
          Tibetan ground jay  ==
B D               Zebra finch  ==
  D    White-throated sparrow  ==
B D           Tasmanian devil  ==
B D              Nile tilapia  ==
B D             X. tropicalis  --
B D            Painted turtle  ==
  D           Green seaturtle  ==
B D        American alligator  ==
  D             Scarlet macaw  ==
B D                Budgerigar  ==
  D               Rock pigeon  ==
B D       Medium ground finch  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D                    Parrot  ==
  D    Spiny softshell turtle  ==
  D  Chinese softshell turtle  ==
B D                       Cat  ==
  D       Collared flycatcher  ==
             Star-nosed mole  ==
            Black flying-fox  ==
B D          White rhinoceros  --
        David's myotis (bat)  ==

Alignment block 45 of 324 in window, 136131141 - 136131142, 2 bps 
B D                     Human  tc
B D                     Chimp  tc
B D                   Gorilla  tc
B D                    Rhesus  tc
B D       Crab-eating macaque  tc
B D                    Baboon  tc
                 Green monkey  tc
B D                  Marmoset  tc
           Chinese tree shrew  tc
       Lesser Egyptian jerboa  tc
                 Prairie vole  tc
B D                      Pika  tc
B D                       Cow  tc
B D                     Sheep  tc
                Domestic goat  tc
B D                     Horse  tc
B D                       Dog  tc
B D                   Ferret   tc
                 Weddell seal  tc
                Big brown bat  tc
B D                   Opossum  tc
B D           Tasmanian devil  tc
B D                  Platypus  tc
  D              Saker falcon  tc
  D          Peregrine falcon  tc
  D       Collared flycatcher  tc
  D    White-throated sparrow  tc
B D       Medium ground finch  tc
B D               Zebra finch  tc
           Tibetan ground jay  tc
B D                Budgerigar  tc
  D                    Parrot  tc
  D             Scarlet macaw  tc
  D               Rock pigeon  tc
  D              Mallard duck  tc
B D                   Chicken  tc
B D                    Turkey  tc
B D        American alligator  tc
  D           Green seaturtle  tc
B D            Painted turtle  tc
  D  Chinese softshell turtle  tc
  D    Spiny softshell turtle  tc
B D             X. tropicalis  tc
B D                Coelacanth  tt
B D                 Tetraodon  tc
B D                      Fugu  tc
       Yellowbelly pufferfish  tc
B D              Nile tilapia  tg
          Princess of Burundi  tc
        Burton's mouthbreeder  tc
                  Zebra mbuna  tc
B D                    Medaka  tc
           Southern platyfish  cc
B D              Atlantic cod  tc
B D                 Zebrafish  tc
                  Spotted gar  tc
B D                 Orangutan  ==
B D                    Gibbon  NN
B D               Stickleback  --
B D                       Cat  ==
             Star-nosed mole  ==
            Black flying-fox  ==
B D          White rhinoceros  --
        David's myotis (bat)  ==

Alignment block 46 of 324 in window, 136131143 - 136131148, 6 bps 
B D                     Human  ccacaa
B D                     Chimp  ccacaa
B D                   Gorilla  ccacaa
B D                    Rhesus  ccacag
B D       Crab-eating macaque  ccacag
B D                    Baboon  ccacag
                 Green monkey  ccacag
B D                  Marmoset  ccacag
           Chinese tree shrew  ccatgt
       Lesser Egyptian jerboa  ccacat
                 Prairie vole  ccacat
B D                      Pika  ccacag
B D                       Cow  ccacag
B D                     Sheep  ccacag
                Domestic goat  ccacag
B D                     Horse  ccacat
B D                       Dog  ccacag
B D                   Ferret   ccacag
                 Weddell seal  ccacag
                Big brown bat  ccagag
B D                   Opossum  ccacat
B D           Tasmanian devil  ccagag
B D                  Platypus  ccacat
  D              Saker falcon  ccataa
  D          Peregrine falcon  ccataa
  D       Collared flycatcher  ccagta
  D    White-throated sparrow  ccagta
B D       Medium ground finch  ccagta
B D               Zebra finch  ccagta
           Tibetan ground jay  ccagta
B D                Budgerigar  ccatac
  D                    Parrot  ccataa
  D             Scarlet macaw  ccataa
  D               Rock pigeon  ccataa
  D              Mallard duck  ccataa
B D                   Chicken  ccatag
B D                    Turkey  ccatat
B D        American alligator  ccagta
  D           Green seaturtle  ccacac
B D            Painted turtle  ccacaa
  D  Chinese softshell turtle  ccacag
  D    Spiny softshell turtle  ccacac
B D             X. tropicalis  ccacag
B D                Coelacanth  ccacaa
B D                 Tetraodon  ccagca
B D                      Fugu  ccagca
       Yellowbelly pufferfish  ccagca
B D              Nile tilapia  ccacag
          Princess of Burundi  ccagca
        Burton's mouthbreeder  ccagca
                  Zebra mbuna  ccagca
          Pundamilia nyererei  ccatag
B D                    Medaka  aaagca
           Southern platyfish  aca--a
B D               Stickleback  -caaag
B D              Atlantic cod  ccagca
B D                 Zebrafish  ccacat
                  Spotted gar  ccacag
B D                 Orangutan  ======
B D                    Gibbon  NNNNNN
B D                       Cat  ======
             Star-nosed mole  ======
            Black flying-fox  ======
B D          White rhinoceros  ------
        David's myotis (bat)  ======

Alignment block 47 of 324 in window, 136131149 - 136131180, 32 bps 
B D                     Human  gtactcgggggagagcaccttggtgggtttgt
B D                     Chimp  gtactcgggggagagcaccttggtgggtttgt
B D                   Gorilla  gtactcgggggagagcaccttggtgggtttgt
B D                    Rhesus  gtactcgggggagagcaccttggtgggtttgt
B D       Crab-eating macaque  gtactcgggggagagcaccttggtgggtttgt
B D                    Baboon  gtactcgggggagagcaccttggtgggtttgt
                 Green monkey  gtactcgggggagagcaccttggtgggtttgt
B D                  Marmoset  gtactcgggggatagcaccttggtgggtttgt
           Chinese tree shrew  gtactctgggt-cagcatgtgggt-ggcttgt
       Lesser Egyptian jerboa  gtactctggggacagcaccttagtgggcttgt
                 Prairie vole  gtactccggggacagcacctttgtaggcttgt
B D                      Pika  gtactcgggggacagcaccttggtgggcttgt
B D                       Cow  gtactcgggggacagcaccttgctgggcttgt
B D                     Sheep  gtactcgggggacagcaccttgctgggcttgt
                Domestic goat  gtactcgggggacagcaccttgctgggcttgt
B D                     Horse  gtactccggggacagcaccttggtgggcttgt
B D                       Dog  gtactctggggacagcaccttggtgggcttgt
B D                   Ferret   gtactccggggacagcaccttggtgggcttgt
                 Weddell seal  gtactctggggacagcaccttggtgggcttgg
                Big brown bat  gtactcgggggacagcaccttggtgggcttgt
B D                   Opossum  atattctgggggaaggactttggtgggtttgt
B D           Tasmanian devil  atactcaggagacaggaccttggagggcttgt
B D                  Platypus  gtattctggagaaagaactttggttggtttat
  D              Saker falcon  atactctggagaaagcaccttggagggtttgt
  D          Peregrine falcon  atactctggagaaagcaccttggagggtttgt
  D       Collared flycatcher  gtactctggggacagcaggcgtgtgggtttgt
  D    White-throated sparrow  gtactctggggacagcagcctggtgggtttgt
B D       Medium ground finch  gtactctggggacagcagccgagtgggtttgt
B D               Zebra finch  gtactctggggacagcaggcgtgtgggcctgt
           Tibetan ground jay  gtactctggggacagcaggcgtgtgggcctgt
B D                Budgerigar  atactctggagaaaacaccttggagggtctgt
  D                    Parrot  atactctggagaaagcaccttggagggttggt
  D             Scarlet macaw  atactctggagaaagcaccgtggagggtttgt
  D               Rock pigeon  atactctggagaaagcactttggagggtttgt
  D              Mallard duck  atactctggagagagtactttagagggtttgt
B D                   Chicken  atattctggagagagcaacttagagggtttgt
B D                    Turkey  atattctggagagagcaccttggagggtttat
B D        American alligator  atactctggggatagcaggcatgtggacttgt
  D           Green seaturtle  gtactccggggagaggagctttgagggcttgt
B D            Painted turtle  gtattccggagaaagtattttggttggtttgt
  D  Chinese softshell turtle  gtattctggggaaagtattttagttggtttgt
  D    Spiny softshell turtle  gtattctggggaaagtattttagttggtttgt
B D             X. tropicalis  atactcgatggaaagaattttggttggcttat
B D                Coelacanth  gtattcaattgaaagaaccttggatggtttat
B D                 Tetraodon  gtactccggagagagcacccgactaggtttat
B D                      Fugu  gtactctggagagagcacccgacttggtttgt
       Yellowbelly pufferfish  gtactctggagagagcacccgacttggtttgt
B D              Nile tilapia  gtactcaggtgacagcaccttgctgggtttgt
          Princess of Burundi  gtactctggagaaagcaccctgctaggtttgt
        Burton's mouthbreeder  gtactctggagaaagcaccctgctaggtttgt
                  Zebra mbuna  gtactctggagaaagcaccctgctaggtttgt
          Pundamilia nyererei  gtactcaggtgacagcaccttgctgggtttgt
B D                    Medaka  atactcagaagaaagtattctgctgggtttgt
           Southern platyfish  gtactcaggagacagaaccttactgggcttgt
B D               Stickleback  gtactcgggtgagagcaccttactgggcttgt
B D              Atlantic cod  gtactctggggagagcaccttgctgggtctgt
B D                 Zebrafish  gtactcaggtgaaagcagtttactgggtttgt
                  Spotted gar  gtattctggagacagcagcgtagtgggcttgt
B D                   Lamprey  gtactcgggggacagcaccttggtgggccgc-
B D                 Orangutan  ================================
B D                    Gibbon  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                       Cat  ================================
             Star-nosed mole  ================================
            Black flying-fox  ================================
B D          White rhinoceros  --------------------------------
        David's myotis (bat)  ================================

Inserts between block 47 and 48 in window
         Pundamilia nyererei 96bp
B D              Stickleback 22bp
B D                Zebrafish 3bp
                 Spotted gar 2bp

Alignment block 48 of 324 in window, 136131181 - 136131191, 11 bps 
B D                     Human  ----ggcgcagcagg
B D                     Chimp  ----ggcgcagcagg
B D                   Gorilla  ----ggcgcagcagg
B D                    Rhesus  ----ggcgcagcagg
B D       Crab-eating macaque  ----ggcgcagcagg
B D                    Baboon  ----ggcgcagcagg
                 Green monkey  ----ggcgcagcagg
B D                  Marmoset  ----ggcgcagcagg
           Chinese tree shrew  ----ggcacagcagg
       Lesser Egyptian jerboa  ----ggtatagcagg
                 Prairie vole  ----ggtacagcagg
B D                      Pika  ----ggtagagcagg
B D                       Cow  ----gcgacagcagg
B D                     Sheep  ----gcgacagcagg
                Domestic goat  ----gcgacagcagg
B D                     Horse  ----ggtccaggagg
B D                       Dog  ----ggtccagcagg
B D                   Ferret   ----ggtagagaagg
                 Weddell seal  ----ggtagagaagg
                Big brown bat  ----gcgagaggaag
B D                   Opossum  ----gaagaaatagg
B D           Tasmanian devil  ----gggaaatgaag
B D                  Platypus  ----ggtaaagcaga
  D              Saker falcon  ----gggagatgaag
  D          Peregrine falcon  ----gggagatgaag
  D       Collared flycatcher  ----gctgcagcagg
  D    White-throated sparrow  ----gctgcaggagg
B D       Medium ground finch  ----gctgcaggagg
B D               Zebra finch  ----gctgcagcagg
           Tibetan ground jay  ----gatgcaggagg
B D                Budgerigar  ----ggaagaggaag
  D                    Parrot  ----gtgagaggaag
  D             Scarlet macaw  ----------ggaag
  D               Rock pigeon  ----gggagaggaag
  D              Mallard duck  ----gggagagaaaa
B D                   Chicken  ----gggtgagaaag
B D                    Turkey  ----gggagagaaag
B D        American alligator  ----ggtaaaggagg
  D           Green seaturtle  ----gggaaaagaag
B D            Painted turtle  ----agtaaacaaaa
  D  Chinese softshell turtle  ----ggtaaacaaaa
  D    Spiny softshell turtle  ----ggtaaataaaa
B D             X. tropicalis  ----gatacaggaaa
B D                Coelacanth  ----tgaaaatgaaa
B D                 Tetraodon  ----gaagcagcatg
B D                      Fugu  ----taagcaacatg
       Yellowbelly pufferfish  ----taagcaacatg
B D              Nile tilapia  ----tgatccacatg
          Princess of Burundi  ----gcagccacagg
        Burton's mouthbreeder  ----gcagccacagg
                  Zebra mbuna  ----gcagccacagg
B D                    Medaka  ----taagc------
           Southern platyfish  ----tcagcaacatg
B D               Stickleback  ----agaacagaagg
B D              Atlantic cod  ----gcagccaaaag
B D                 Zebrafish  ----acagcaaa---
                  Spotted gar  ----taaataaag--
B D                   Lamprey  cgctcggccgccagg
B D                 Orangutan  ===============
B D                    Gibbon  NNNNNNNNNNNNNNN
         Pundamilia nyererei  ===============
B D                       Cat  ===============
             Star-nosed mole  ===============
            Black flying-fox  ===============
B D          White rhinoceros  ---------------
        David's myotis (bat)  ===============

Inserts between block 48 and 49 in window
B D             Nile tilapia 85bp
B D                   Medaka 6bp
          Southern platyfish 75bp
B D              Stickleback 51bp

Alignment block 49 of 324 in window, 136131192 - 136131238, 47 bps 
B D                     Human  tacttgttcaggtggctctcgtcgtgccacacggcctcgatgccgtt
B D                     Chimp  tacttgttcaggtggctctcgtcgtgccacacggcctcgatgccgtt
B D                   Gorilla  tacttgttcaggtggctctcgtcgtgccacacggcctcgatgccgtt
B D                    Rhesus  tacttgttcagatggctctcgtcgtgccacacggcctcgatgccgtt
B D       Crab-eating macaque  tacttgttcagatggctctcgtcgtgccacacggcctcgatgccgtt
B D                    Baboon  tacttgttcaggtggctctcgtcgtgccacacggcctcgatgccgtt
                 Green monkey  tacttgttcaggtggctctcgtcgtgccacacggcctcgatgccgtt
B D                  Marmoset  tacttgttcaggtggctctcgtcgtgccacacggcctcgatgccatt
           Chinese tree shrew  gacttgctcaggtggttcttgatgtgccacacagccccgacgccatt
       Lesser Egyptian jerboa  tacttgttcaggtggctctcatcgtgccacacggcctcaatgccatt
                 Prairie vole  tacttgttcagatgactctcatcatgccacacggcctcgatgccatt
B D                      Pika  tacttgttcaggtggctctcgtcatgccacacggcctcgatgccact
B D                       Cow  tatcggttcaggtggctctcgtcatgccacacggcctcgatgccctg
B D                     Sheep  taccggttcaggtggctctcgtcgtgccagatggcctcgatgccctg
                Domestic goat  taccggttcaggtggctctcgtcgtgccagacggcctcgatgccctg
B D                     Horse  tacctgtttaggtggctcttgtcgtgccacacggcctcgatgctatt
B D                       Dog  tacctgttcaggtggctctcatcgtgccacacggcctcgagcccgtt
B D                   Ferret   tacctgttcaggtggctctcgtcatgccacacggcctcgatcccatt
                 Weddell seal  tacctgttcaggtggctctcgtcgtgccacacggcctcgatcccact
                Big brown bat  cggcggttcaggtggctctcctcctgccaggccgccatgatgccgtt
B D                   Opossum  tatttgtttaaatggctctcatcatgccacactgcttcaatcctatt
B D           Tasmanian devil  cgccgattcaggtggctctcctcctgccaggcagccatgatgccgtt
B D                  Platypus  tatttgtttaggtgactctcatcgtgccaaactgcttcaatgcgatt
  D              Saker falcon  tgcctattgagatgactttcttcctgccaggctgccatgatcccatt
  D          Peregrine falcon  tgcctattgagatgactttcttcctgccaggctgccatgatcccatt
  D       Collared flycatcher  tacttgttgaggtgcctctcatggtgcccccaagcctcaattccatt
  D    White-throated sparrow  tacctgttgaggtggctctcgtggtgccagggaccctcaatgccatt
B D       Medium ground finch  tacctgttgaggtgcctctcgtggtgccagggaccctcaattccatt
B D               Zebra finch  tacctgttgaggtggctctcgtggtgccagggagcctcaatgccatt
           Tibetan ground jay  tatttgttgaggtggctctcatggtgccaccaagcctcaattccatt
B D                Budgerigar  tgctggttgagatgactttcttcctgccaggctgccatgatcccatt
  D                    Parrot  tgcctgttgagattacttccttcccgccaggctgccatgatcccatt
  D             Scarlet macaw  tgcctgttgagattactttcttcctgccaggctgccatgatcccatt
  D               Rock pigeon  tgcctgttgagatgactttcttcttgccaggctgccatgatcccatt
  D              Mallard duck  tgcctgttgaggtggctttcttccttccaggccgccatgattccgtt
B D                   Chicken  tgtctgttgagatggctttcttcctgccaggctgccatgatcccatt
B D                    Turkey  tgcctgttgagatggctttcttcctgccaggctgccatgatcccatt
B D        American alligator  gacttgttcaagtgaccctcctcatgtcatttggcttcattgccatc
  D           Green seaturtle  tgcctattgaggtggctctcctcttgccaggtcgccatgatcccgtt
B D            Painted turtle  tacttgtttaagtgactctcatcgtgccagattgcctcaattccatt
  D  Chinese softshell turtle  tacttgtttaagtgactctcttcttgccatattgcctcaattccatt
  D    Spiny softshell turtle  tacttgtttaagtgactctcttcttgccatattgcctcaattccatg
B D             X. tropicalis  tatttgttgagataactctcatcgtgccaaattgcttctatgttgtg
B D                Coelacanth  tacctgttcaggtgactctcctcctgccacgctgcctgaatgccttt
B D                 Tetraodon  aacttgttgaggtggctctcgtcgtgccacagagcctccacgtgatt
B D                      Fugu  tacttgttgaggtggctctcgtcgtgccacagagcctccacgttgtt
       Yellowbelly pufferfish  tacttgttgaggtggctctcgtcgtgccacagagcctccacgttgtt
B D              Nile tilapia  tacctgttcaggtgactctcctcctgccaagctgcctcgatgccctt
          Princess of Burundi  tatttgtttaggtgactttcatcgtgccacaaagcctccacgttatt
        Burton's mouthbreeder  tatttgtttaggtgactttcatcgtgccacaaagcctccacattatt
                  Zebra mbuna  tatttgtttaggtgactttcatcgtgccacaaagcctccacattatt
          Pundamilia nyererei  tacctgttcaggtgactctcctcctgccaagctgcctcgatgcccct
B D                    Medaka  tacttgtttaaatgactctcatcatgccacaaagcttcaacattgtt
           Southern platyfish  tacctgttcaagtggctctcctcctgccaggcggcctcaatgccttc
B D               Stickleback  tacctgttgaggtgactctcctcctgccaggcagcttcaatgccctc
B D              Atlantic cod  tatttgttgaggtggctctcgtcgtgccacagtgcctccacgccgtt
B D                 Zebrafish  tacttattcaaatgggactcctcctgccatgctgcctcaatggattt
                  Spotted gar  tatttattgaggtgactctcttcctgccagacggcttcaatattatt
B D                   Lamprey  tagcggttcaggtgactctcatcgtgccaaagggcctccaccccgcg
B D                 Orangutan  ===============================================
B D                    Gibbon  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                       Cat  ===============================================
             Star-nosed mole  ===============================================
            Black flying-fox  ===============================================
B D          White rhinoceros  -----------------------------------------------
        David's myotis (bat)  ===============================================

Inserts between block 49 and 50 in window
B D               Budgerigar 1086bp

Alignment block 50 of 324 in window, 136131239 - 136131272, 34 bps 
B D                     Human  g-------gcctggtcgaccatcatggcctggtggcaggcc
B D                     Chimp  g-------gcctggtcgaccatcatggcctggtggcaggcc
B D                   Gorilla  g-------gcctggtcgaccatcatggcctggtggcaggcc
B D                    Rhesus  g-------gcctggtcgaccatcatggcctggtggcaggcc
B D       Crab-eating macaque  g-------gcctggtcgaccatcatggcctggtggcaggcc
B D                    Baboon  g-------gcctggtcgaccatcatggcctggtggcaggcc
                 Green monkey  g-------gcctggtcgaccatcatggcctggtggcaggcc
B D                  Marmoset  g-------gcctggtccatcatcatagcctggtggcaggcc
           Chinese tree shrew  g-------gcctggtctgccatcatggcctgatggcgggcc
       Lesser Egyptian jerboa  g-------ccctggtcgaccaccatggcttcatgacaggac
                 Prairie vole  g-------gccttgtcctccactatagcctgatggcaggcc
B D                      Pika  g-------gccttgtccagcagcatggcctggtggcaggtg
B D                       Cow  g-------gcctggtcggccgtcatggcctggtggcaggcc
B D                     Sheep  g-------gcctggtcagccgccatggcctggtgacaggcc
                Domestic goat  g-------gcctggtcggccgtcatggcctggtgacaggcc
B D                     Horse  g-------gcccggtcggccactatcgcctggtgacaggcc
B D                       Dog  g-------gcctggtccaccaccatcgcctggtgacaagct
B D                   Ferret   g-------gcctgatcgatcaccatcgcccggtgacaggcc
                 Weddell seal  g-------gcccagtcgaccaccatcgcctggtgacaggct
                Big brown bat  g-------gccttgtccgccaagatggccatgtggcagccc
B D                   Opossum  a-------cttttgtcaatcaacatagcttcatgacaagcc
B D           Tasmanian devil  g-------gctttgtctgccagaatggccatgtgacagcct
B D                  Platypus  g-------ctcttgtccatcatcatggcttggtgacactcc
  D              Saker falcon  g-------gctttgtccgtcaggatggtcatgtggcaagtc
  D          Peregrine falcon  g-------gctttgtccgtcaggatggtcatgtggcaagtc
  D       Collared flycatcher  t-------tctctgtcctcccccagccccctaaaacaggct
  D    White-throated sparrow  t-------tctctgtcctgcagcagccctgcagagcaggct
B D       Medium ground finch  t-------tctctgtcctgcaccagccctgcagagcaggct
B D               Zebra finch  t-------tctgtgtcctccctcagccctgcagagcaggct
           Tibetan ground jay  t-------tctctgtcctccatcagcccttcagaacaggct
  D                    Parrot  g-------gctttgtccatcaggatggtcatgtggcaaatc
  D             Scarlet macaw  g-------gctttgtccatcaggatggtcatgtggcaaatc
  D               Rock pigeon  g-------gctttgtctgtcaggatggtcatgtggcaagtc
  D              Mallard duck  g-------gctttgtctgtcaggatcgtcatgtggcaagtc
B D                   Chicken  g-------gctttgtctgccaggatggtcatgtggcagatc
B D                    Turkey  g-------gctttgtctgccaggatagtcaagtggcaagtc
B D        American alligator  a-------actctgtcttccatggctcctttaaagcaggct
  D           Green seaturtle  g-------gctttgtccgccaggatggtcatgtggcaggcc
B D            Painted turtle  g-------gctttgtccaccatcatggcttcatggcatttc
  D  Chinese softshell turtle  g-------tctttgtccaccatgatggcttcatggcatttc
  D    Spiny softshell turtle  g-------tctttgtccaccatgatggcttcatggcatttc
B D             X. tropicalis  t-------tctttgtccgtcatcatggcataatggcagaag
B D                Coelacanth  g-------gcatcatctttcaaaatacctttcttgcaggtt
B D                 Tetraodon  c-------tttttatcctccatgatgccctggtagcaggcc
B D                      Fugu  c-------tttttatcctccatgatgctcttgtagcaggtc
       Yellowbelly pufferfish  c-------tttttatcctccatgatgctcttgtagcaggtc
B D              Nile tilapia  c-------ttggtgtcatcctcaaagttcttgcggcaggtt
          Princess of Burundi  t-------tgtttatcctccatgatgttttggtagcaggcc
        Burton's mouthbreeder  t-------tgtttatcctccatgatgttttggtagcagccc
                  Zebra mbuna  t-------tgtttatcctccatgatgttttggtagcagccc
          Pundamilia nyererei  c-------ttggcgtcgtcctcaaagttcttgcggcaggtt
B D                    Medaka  cagtttatcctccattgtgttcaaa----tagcaataatct
           Southern platyfish  c-------ttggcatcgtcttcgaagttcttgcgacaggtt
B D               Stickleback  c-------tgggcgtcagcctcaaagttgtggcggcaggtt
B D              Atlantic cod  c-------tccatgtcctgcaggatcccctgatagcagacc
B D                 Zebrafish  a-------gctgcatcgatgtccagctgctctcggcaggtt
                  Spotted gar  t-------gctttgtctaccaaaatgttcctgtaacaggtc
B D                   Lamprey  g-------tcacggtcctcgctgatcgtctgtggagaggtc
B D                 Orangutan  =========================================
B D                    Gibbon  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                Budgerigar  =========================================
B D                       Cat  =========================================
             Star-nosed mole  =========================================
            Black flying-fox  =========================================
B D          White rhinoceros  -----------------------------------------
        David's myotis (bat)  =========================================

Inserts between block 50 and 51 in window
B D                  Lamprey 1070bp

Alignment block 51 of 324 in window, 136131273 - 136131372, 100 bps 
B D                     Human  ctg----gtgagccgctgcacctcttgcaccga-c-cccccgaagaaccccc-ccaggtagtagaaatcg
B D                     Chimp  ctg----gtgagccgctgcacctcttgcaccga-c-cctccgaagaaccccc-ccaggtagtagaaatcg
B D                   Gorilla  ctg----gtgagccgctgcacctcttgcaccga-c-cccccgaagaacgccc-ccatgtagtagaaatcg
B D                    Rhesus  ctg----gtgagccgctgcacctcctgcaccga-c-cccccgaagaacgccc-ccatgtagtagaaatca
B D       Crab-eating macaque  ctg----gtgagccgctgcacctcctgcaccga-c-cccccgaagaacgccc-ccatgtagtagaaatca
B D                    Baboon  ctg----gtgagccgctgcacctcctgcaccga-c-cctccgaagaacgccc-ccaagtagtagaaatca
                 Green monkey  ctg----gtgagccgctgcacctcctgcaccga-c-cccccgaagaaccccc-ccaagtagtagaaatca
B D                  Marmoset  ctg----gtaagccgctgcacctctggcactga-c-cccccgaagaaccccc-ccaggtagtagaaatct
           Chinese tree shrew  ttg----gtgagctgggacacctctgtcactga----------------ccc-ccacatagtagaagtca
       Lesser Egyptian jerboa  ttg----gtgaggtgatacacctccattacaga-t-cccccaaagaaggccc-ccatgtagtaaaaatca
                 Prairie vole  ttg----gtgagatggtatacctccaccactga-c-cccccaaagaaggccc-ccatgtaataaaagtcg
B D                      Pika  ctg----gccagccgttgcacctcggccaccga-g-cccccgaacaaggctc-ccatatagtagaagtcg
B D                       Cow  gtg----gtgagccggtaaacctcagggaccga-c-cccccaaaaaagcctc-ccgcgtagtagaaatca
B D                     Sheep  gtg----gtgagccggtaaacctcagggaccga-c-cccccaaaaaagcctc-ccgcgtagtagaagtca
                Domestic goat  gtg----gtgagccggtaaacctcagggaccga-c-cccccaaaaaagcctc-ccgcgtagtagaagtca
B D                     Horse  ttg----gtaagccggtaaacctcagacactgacc-cccccaaaaaaggccc-ccatgtagtaaaagtcg
B D                       Dog  gtg----gtcagctggagaacctcgaccaccga-c-cccccgaaaaagcccc-ctgcatagtaaaagtca
B D                   Ferret   gag----gtcagccggagaacctcggccactga-c-cccccaaaaaagcctc-ctgcgtagtagaagtca
                 Weddell seal  gag----gtcagttgg-gaacctccaccactga-a-cccccagaaaggcctc-ctgcgtagtaaaagtca
                Big brown bat  ctc----gtgaactcgtacaccctgtccacccg-g-cccccgaagaccgccc-cgccgtagtagaagtcc
B D                   Opossum  ttg----gtcaatttataaacctgttgtacttt-g-cctccaaaaaaacccc-ccatataataataatca
B D           Tasmanian devil  cct----gtgaactcgtacaccctttctactcg-g-ccaccaaacactgccc-caccgtagtagaagtct
B D                  Platypus  ttg----gtgagcttgtacacctcgctcactgt-c-cctccaaaaaaggccc-ccatgtagtagaagtcc
  D              Saker falcon  ttg----gtgagctcatagacttgctggaccag-c-cctccaaacacagctc-ctccatagtagaagtcc
  D          Peregrine falcon  ttg----gtgagctcatagactttctggaccag-c-cctccaaacacagctc-ctccatagtagaagtcc
  D       Collared flycatcher  gtg----gtcaatttgtgcacctcagacacact-g-ccgccataga-agctggcagtgtaatggaagtcc
  D    White-throated sparrow  ctg----ctcagcttgtacacctcagccacgct-g-cccccataga-agctggcagtgtagtggaagtcc
B D       Medium ground finch  ctg----gtcagcttgtacacctcggccacgct-g-cccccataga-agctggctgtgtagtggaagtcc
B D               Zebra finch  cgg----gtcagtttgtagacctcgggcacgct-g-cccccataga-agctcgctgtgtagtagaagtcc
           Tibetan ground jay  cgg----gtcagtttgtagacctcagacacgct-g-cccccgtaga-agctcgctgtgtaatggaagtcc
  D                    Parrot  ttg----gtgaactcatagactttcttgatgag-c-ccttcaaacacagctcctcctct-gcagaagtcc
  D             Scarlet macaw  ttg----gtgaactcatagactttcttgatgag-c-cctccaaacatagctcctcctct-gcagaagtcc
  D               Rock pigeon  ttg----gtgaactcatagactttcttgaccag-c-cctccaaacacagctc-ctccgtagtagaagtcc
  D              Mallard duck  ttg----gtgaactcatagaccttcctgaccag-c-cctccaaacacggctc-ctccgtagtagaagtcc
B D                   Chicken  ttg----gtgaactcgtagaccttcttgaccag-c-cctccaaacacagctc-ctccatagtagaagtcc
B D                    Turkey  ttg----gtgaactcatagaccttcttgaccag-c-cctccaaacacagctc-ctccatagtagaagtcc
B D        American alligator  gtg----gtcagcttgtagacctcagaaatgct-a-ccaccataga-agctggctgtatagtagaagtcc
  D           Green seaturtle  ctg----gtaaactcgtacacctgcttgaccag-c-ccgccgaagacggccc-ctgcatagtagaagtcc
B D            Painted turtle  ttg----gtcagcatgtaaacctccattactgt-t-cctccaaaaaaggctc-caatatagtagaagtca
  D  Chinese softshell turtle  ttg----gtcagcttgtaaacctcctttactgt-t-cctccaaaaaatgctg-cagcatagtaaaagtca
  D    Spiny softshell turtle  ttg----gtcagcttgtaaacctcctttgctgt-t-cctccaaaaaatgctc-cagcatagtagaagtca
B D             X. tropicalis  tcg----gtcagtttgtagacctcctcaacggt-g-cctccaaaaaatcctc-ctgcataataaaagtcc
B D                Coelacanth  ctt----gtgaattcgtacactttagagacgag-c-cccccaaaaattgctc-ctccatagtagaagtct
B D                 Tetraodon  tcc----gtcagagccttcacccaccgccacga-g-cctccgaacacggctg-cgtgatagtagaaatcg
B D                      Fugu  tcc----gtcagggccttcacactctcccacga-g-cctccgaagacggcgg-cgtgatagtagaagtcg
       Yellowbelly pufferfish  tcc----gtcagggccttcacactctcccacga-g-cctccgaagacggcgg-cgtgatagtagaagtcg
B D              Nile tilapia  ttg----gcgagcaggtgaacttcctgcatcaa-c-cccccaaacgcccctc-cacagtagtagaagtcc
          Princess of Burundi  tca----gccagagattttacgcttttccatga-g-cctccaaagacagcag-catgatagtagaaatcc
        Burton's mouthbreeder  tca----gccagagattttacgcttttccatga-g-cctccaaagacagcag-catgatagtagaaatcc
                  Zebra mbuna  tca----gccagagattttacgcttttccatga-g-cctccaaagacagcag-catgatagtagaaatcc
          Pundamilia nyererei  ttg----gcgagcaggtgaacttcttccaccaa-c-cccccgaacgcccctc-cacagtagtagaagtcc
B D                    Medaka  -------gccaatgctttaactgcatcacatga-c-cctccaaagactgccg-catggtaatagtaatct
           Southern platyfish  tgagcgagctgatg----aacctcggc-cagga-cgcctccgaaggcgccac-cgcagtagtagaagtcg
B D               Stickleback  ttg----gcgaggtgatgcacctcctgtagcag-a-cccccaaaggcacccc-cgcagtagtagaagtct
B D              Atlantic cod  tcg----gccagggccttcacgctggcgcagga-g-cctccgaacacggctg-cgtggtagtagaagtcc
B D                 Zebrafish  tta----gcaacctcatgtacatctttcacttt-a-ccaccaagcacagctc-cacaataataataatca
                  Spotted gar  ctg----gtcagcctataaacgttttcagcaag-c-cctccaaacacggctc-cgccgtagtagaaatcg
B D                   Lamprey  tgg----gccaaggcgaacacgtccctgcagcg-g-ccgccgaacagctcgg-aggtgaagtagaagtct
B D                 Orangutan  ======================================================================
B D                    Gibbon  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                Budgerigar  ======================================================================
B D                       Cat  ======================================================================
             Star-nosed mole  ======================================================================
            Black flying-fox  ======================================================================
B D          White rhinoceros  ----------------------------------------------------------------------
        David's myotis (bat)  ======================================================================

                        Human  ccctcgtccttggggatgtaggcctggga-----------------ctggggcc
                        Chimp  ccctcatccttggggatgtaggcctggga-----------------ctggggcc
                      Gorilla  ccctcgtccttggggatgtaggcctggga-----------------ctggggcc
                       Rhesus  ccctcgtccttggggatgtaggcctggga-----------------ctgaggcc
          Crab-eating macaque  ccctcgtccttggggatgtaggcctggga-----------------ctggggcc
                       Baboon  ccctcgtccttggggatgtaggcctggga-----------------ctggggcc
                 Green monkey  ccctcgtccttggggatgtaggcctggga-----------------ctggggcc
                     Marmoset  ccctcgtccctggggatgtaggcctggga-----------------ctggggcc
           Chinese tree shrew  ccctcgt-ctgagggatgtgggcctggga-----------------ctgagggt
       Lesser Egyptian jerboa  ccctccccctggggtatgaaggcctgaga-----------------ctggggcc
                 Prairie vole  cccttatcccagggaatgtaggcccggga-----------------cttcggcc
                         Pika  ccctggccgcggggaatgtaggcctggga-----------------ctgcggcc
                          Cow  ccctcgtctctcgggatgtaggctcgaga-----------------caagggcc
                        Sheep  ccctcgtctctcgggatgtaggctcgaga-----------------caggggcc
                Domestic goat  ccctcgtctctcgggatgtaggctcgaga-----------------caggggcc
                        Horse  ccctggtcccggggtatgtgcgcctgtga-----------------ctgcggcc
                          Dog  ccctcgtctctcggaatgtaggcctggga-----------------ctgcggcc
                      Ferret   ccctcgtctctgggaatgtaggcctggga-----------------ctgcggcc
                 Weddell seal  ctctgggccctggggatg-gcccctggga-----------------ccacgtcc
                Big brown bat  ccctcgccgtccgccacgaaggcggtgga-----------------cacgtgcc
                      Opossum  cccttgcctctgggaatgtaggcttggga-----------------tttagggc
              Tasmanian devil  ccctcaccatcagcaacaaaagctgtgga-----------------caagggcc
                     Platypus  ccctcgtccaggggaatgtaggcttgaga-----------------caagggcc
                 Saker falcon  ccttctccatcagggatgtagcctgctga-----------------agatctcc
             Peregrine falcon  ccttctccatcagggatgtagcctgctga-----------------agatctcc
          Collared flycatcher  cct---------------------tgtggctcagggcgtgtcc--catgggctt
       White-throated sparrow  ccttgtccctcagggagggcaggctgtgactcagggtgtgtct--cagaggctt
          Medium ground finch  ccttgtccctcagggatggcagattgtgactcagggtgtgtct--cagaggctt
                  Zebra finch  ccttgtccctcagggatggcagattgtgcctcagggtgtgcct--cagagcctt
           Tibetan ground jay  ccttgtccctcagggatggcagcttgtgactcaggatgtgtct--catgggcgt
                       Parrot  ccttcttcatcagggatgtagggtgctga-----------------agagctct
                Scarlet macaw  ccttcttcatcagggatgtaggctgctga-----------------agagctgc
                  Rock pigeon  ccctctccatcagggatgtaggctgctga-----------------agatcttc
                 Mallard duck  ccttctccgtcagggatgtaggctgctga-----------------agagctcc
                      Chicken  ccttctccgtcagggatgtaggctgctga-----------------agagctcc
                       Turkey  ccttctccctcagggatgtaggctgctga-----------------agagctcc
           American alligator  ccttctcctttagggatggcagtctatgactccaggtgcgtcttgtaggaaatg
              Green seaturtle  ccctggctgtcagggatgaaggcagcgga-----------------agagctcc
               Painted turtle  ccctcatcactgggcacataggcttgaga-----------------agcaggtc
     Chinese softshell turtle  ccctcatcatggggcacataagcttgaga-----------------agcaggtc
       Spiny softshell turtle  ccctcatcatgaggcacataagcttgaga-----------------agcaggtc
                X. tropicalis  ccctcgtcggcaggtataaaggcctggga-----------------ctctggcc
                   Coelacanth  ccatggtcagcaggtacataggcttctga-----------------gatgggcc
                    Tetraodon  cctcttt------ccatgtaggccacgga-----------------cttggggt
                         Fugu  ccatttt------ccatgtacgccacgga-----------------tttggggt
       Yellowbelly pufferfish  ccatttt------ccatgtacgccacgga-----------------tttggggt
                 Nile tilapia  ccctccccgggagccacataggcgttgga-----------------ggcaggcc
          Princess of Burundi  ccggttt------ccatgtaagccttgga-----------------ttttgggt
        Burton's mouthbreeder  ccgtttt------ccatgtaagccttgga-----------------tttcgggt
                  Zebra mbuna  ccgtttt------ccatgtaagccttgga-----------------tttcgggt
          Pundamilia nyererei  ccctccccgggagccacgtaggcgttgga-----------------cgcaggac
                       Medaka  ccttctt------ccatgtaagctttgga-----------------tttggggt
           Southern platyfish  ccctcgccaggagccacgtaagctctgga-----------------ggtgggcc
                  Stickleback  ccctccccaggagccaggtaggctctcga-----------------tgatggtc
                 Atlantic cod  cccgtca------ccatgaaggcgctgga-----------------ctgcgggt
                    Zebrafish  ccttcagaataagggataaacgcttgaga-----------------ctcaggcc
                  Spotted gar  ccctggtccaggggaatgtttgcctggga-----------------ggcaggcc
                      Lamprey  ccctcgtggcggcccacgcgcgccgccga---------------------ggcc
                    Orangutan  ======================================================
                       Gibbon  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                   Budgerigar  ======================================================
                          Cat  ======================================================
              Star-nosed mole  ======================================================
             Black flying-fox  ======================================================
             White rhinoceros  ------------------------------------------------------
         David's myotis (bat)  ======================================================

Inserts between block 51 and 52 in window
B D                  Lamprey 417bp

Alignment block 52 of 324 in window, 136131373 - 136131404, 32 bps 
B D                     Human  ggcgctcgtagg---tgaag--gcctcccggctgctt
B D                     Chimp  ggcgctcgtagg---tgaag--gcctcccggctgctt
B D                   Gorilla  ggcgctcgtagg---tgaag--gcctcccggctgctt
B D                    Rhesus  ggcgctcgtagg---tgaag--gcctcccggctgctt
B D       Crab-eating macaque  ggcgctcgtagg---tgaag--gcctcccggctgctt
B D                    Baboon  ggcgctcgtagg---tgaag--gcctcccggctgctt
                 Green monkey  ggcgctcgtagg---tgaag--gcctcccggctgctt
B D                  Marmoset  ggcgctcatagg---tgaag--gcctcccggctgctt
           Chinese tree shrew  ggcgc---tagg---tgaag--gggtcctggcttgtc
       Lesser Egyptian jerboa  ggcgctcatagg---tgaag--gcctcccggttgcta
                 Prairie vole  ggcgctcgtaag---taaag--gcctctcggctgctt
B D                      Pika  gccgctcgtagg---tgaag--gcgtcgcggctcgct
B D                       Cow  ggcgctcatagg---tgaag--gactggcggtccgca
B D                     Sheep  ggcgctcatagg---tgaag--gactggcggtcggcg
                Domestic goat  ggcgctcatagg---tgaag--gactggcggtcggcg
B D                     Horse  ggcgctcgtatg---gaaaa--gcctcgcgactggcc
B D                       Dog  ggcgctcgtagg---tgaag--gcctcgcgggccgcc
B D                   Ferret   ggcgctcgtagg---tgaag--gactcgcgggccgcc
                 Weddell seal  agcgctcgtagc---tgaag--tcctcacgggctgcc
                Big brown bat  tgcgctcgtagg---ggaac--tgctggcggggcacg
B D                   Opossum  ggcgttcatagg---tgaag--gtttcccgagaagct
B D           Tasmanian devil  tccgttcataag---ggaac--tgccatcgaggaaca
B D                  Platypus  gccgctcgtagg---tgaag--gatctccgttcggcc
  D              Saker falcon  tcctctcataag---ggaac--tggcttcgagggaca
  D          Peregrine falcon  tcctctcataag---ggaac--tggcttcgagggaca
  D       Collared flycatcher  tgttctcct---------------gctgagaggtgac
  D    White-throated sparrow  tgtcctcct---------------gctgtggggtgac
B D       Medium ground finch  tgtcctcct---------------gctgtgggatgac
B D               Zebra finch  tgttctcgt---------------gctgtggggtgac
           Tibetan ground jay  tgttctcga---------------gctgggaagtgat
  D                    Parrot  tcctctcctaag---ggaac--tggctttgagggaca
  D             Scarlet macaw  tcctctcctaag---ggaac--aggctttgagggaca
  D               Rock pigeon  tcctctcataag---ggaac--tggcttcgagggaca
  D              Mallard duck  tcctctcgtatg---ggaac--tgacttcgagggacg
B D                   Chicken  tcctctcatatg---ggaac--tggcttcgagggaca
B D                    Turkey  tcctctcatatg---ggaac--tggcttcgagggaca
B D        American alligator  gactctctca--------------gctt---ggtgta
  D           Green seaturtle  tcctctcataag---ggaac--tggctgcgagggaca
B D            Painted turtle  gacgttcgtagg---tgaaa--gactgacgctctgca
  D  Chinese softshell turtle  gacgttcatagg---tgaaa--gaccgacgctctgaa
  D    Spiny softshell turtle  gacgttcatatg---tgaaa--gactgacgctctgca
B D             X. tropicalis  gacgctcatagg---taaaa--ctttggcgatcagat
B D                Coelacanth  gtcgctcataag---ggaaa--gaattgcggggcgca
B D                 Tetraodon  tgcggtcatacgtgtagaac--ctctttgggaggcgg
B D                      Fugu  tgcggtcgtacgtgtacagc--ctcttcgggagacgg
       Yellowbelly pufferfish  tgcggtcgtacgtgtacagc--ctcttcgggagacgg
B D              Nile tilapia  tccgctcgtagg---ggaac--ttgctgcggtcatct
          Princess of Burundi  ttcggtcataagtatagaaa--ctctttggaaggtgg
        Burton's mouthbreeder  ttcggtcataagtatagaaa--atctttggaaggtgg
                  Zebra mbuna  ttcggtcataagtatagaaa--atctttggaaggtgg
          Pundamilia nyererei  tccgctcgtagg---ggaac--ctgctgcggtcatct
B D                    Medaka  ttctatcatagg---tgaactgtgtctttggaagt--
           Southern platyfish  gccgttcgtatg---ggaac--ttactgcggtcgtcc
B D               Stickleback  ttcgctcgtagg---ggaac--ttgctgcgtgggtcc
B D              Atlantic cod  tgcggtcgtacgtgtacctc--cccttggggagattg
B D                 Zebrafish  ttcgctcataag---ggaat--tgctcacgtcgtgta
                  Spotted gar  ggcgctcgtaag---gaaag--ttctcccgggagacc
B D                   Lamprey  ggcgatcctcgg---tggca--accccacggcggcaa
B D                 Orangutan  =====================================
B D                    Gibbon  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                Budgerigar  =====================================
B D                       Cat  =====================================
             Star-nosed mole  =====================================
            Black flying-fox  =====================================
B D          White rhinoceros  -------------------------------------
        David's myotis (bat)  =====================================

Inserts between block 52 and 53 in window
               Big brown bat 22675bp

Alignment block 53 of 324 in window, 136131405 - 136131415, 11 bps 
B D                     Human  ccgtagaagcc--
B D                     Chimp  ccgtagaagcc--
B D                   Gorilla  ccgtagaagct--
B D                    Rhesus  ccgtagaaggc--
B D       Crab-eating macaque  ccgtagaaggc--
B D                    Baboon  ccgtagaaggc--
                 Green monkey  ccgtagaaggc--
B D                  Marmoset  ccatagaaggc--
           Chinese tree shrew  ctgtagaagct--
       Lesser Egyptian jerboa  ctgtagaaacc--
                 Prairie vole  ctgtagaagcc--
B D                      Pika  ctgtagaagcc--
B D                       Cow  gcgtagaagcc--
B D                     Sheep  gcgtagaacac--
                Domestic goat  gcgtagaaccc--
B D                     Horse  cgatagtaacc--
B D                       Dog  ccgtagaaacc--
B D                   Ferret   ctgaagaagcc--
                 Weddell seal  ctgtagaaacc--
                Big brown bat  ccgtagaagcc--
B D                   Opossum  ccataaaagcc--
B D           Tasmanian devil  gtaaaatagcc--
B D                  Platypus  ccgtagaagcc--
  D              Saker falcon  ttgaaataacc--
  D          Peregrine falcon  ttgaaataacc--
  D       Collared flycatcher  ctgccaggagc--
  D    White-throated sparrow  ctgccaggagc--
B D       Medium ground finch  ctgccaggagc--
B D               Zebra finch  ctgccaggagc--
           Tibetan ground jay  ctgccaggagc--
  D                    Parrot  ttgaaataggc--
  D             Scarlet macaw  ttgaaataggc--
  D               Rock pigeon  ttgaaatagcc--
  D              Mallard duck  ttgaaatagcc--
B D                   Chicken  ttgaaataacc--
B D                    Turkey  ttgaaataacc--
B D        American alligator  attgcagaatt--
  D           Green seaturtle  ttgtagtaccc--
B D            Painted turtle  gcatagaaacc--
  D  Chinese softshell turtle  ccgtagaatcc--
  D    Spiny softshell turtle  ccgtagaatcc--
B D             X. tropicalis  ccgtagaagcc--
B D                Coelacanth  ttgtaatagcc--
B D                 Tetraodon  tagtagtaggc--
B D                      Fugu  tagtagtaggc--
       Yellowbelly pufferfish  tagtagtaggc--
B D              Nile tilapia  ctgtagtaacc--
          Princess of Burundi  tagtagtaggc--
        Burton's mouthbreeder  tagtagtaggc--
                  Zebra mbuna  tagtagtaggc--
          Pundamilia nyererei  ctgtagtaacc--
B D                    Medaka  ttgtaatagta--
           Southern platyfish  ttgtagtaccc--
B D               Stickleback  ctgtaataacc--
B D              Atlantic cod  tagtacca-----
B D                 Zebrafish  tgatagtaacc--
                  Spotted gar  ttgtagtaccc--
B D                   Lamprey  ---------ccct
B D                 Orangutan  =============
B D                    Gibbon  NNNNNNNNNNNNN
B D                Budgerigar  =============
B D                       Cat  =============
             Star-nosed mole  =============
            Black flying-fox  =============
B D          White rhinoceros  -------------
        David's myotis (bat)  =============

Inserts between block 53 and 54 in window
         Princess of Burundi 4bp
       Burton's mouthbreeder 4bp
                 Zebra mbuna 4bp
         Pundamilia nyererei 929bp
B D              Stickleback 58bp

Alignment block 54 of 324 in window, 136131416 - 136131417, 2 bps 
B D                     Human  gg
B D                     Chimp  ag
B D                   Gorilla  gg
B D                    Rhesus  gg
B D       Crab-eating macaque  gg
B D                    Baboon  gg
                 Green monkey  gg
B D                  Marmoset  gg
           Chinese tree shrew  gg
       Lesser Egyptian jerboa  cg
                 Prairie vole  ag
B D                      Pika  gg
B D                       Cow  ag
B D                     Sheep  gg
                Domestic goat  gg
B D                     Horse  gg
B D                       Dog  gg
B D                   Ferret   gg
                 Weddell seal  ag
                Big brown bat  gg
B D                   Opossum  ag
B D           Tasmanian devil  ag
B D                  Platypus  cg
  D              Saker falcon  ag
  D          Peregrine falcon  ag
  D       Collared flycatcher  tg
  D    White-throated sparrow  tg
B D       Medium ground finch  tg
B D               Zebra finch  tg
           Tibetan ground jay  tg
  D                    Parrot  ag
  D             Scarlet macaw  ag
  D               Rock pigeon  ag
  D              Mallard duck  ag
B D                   Chicken  ag
B D                    Turkey  ag
B D        American alligator  tg
  D           Green seaturtle  ag
B D            Painted turtle  tg
  D  Chinese softshell turtle  tg
  D    Spiny softshell turtle  tg
B D             X. tropicalis  ag
B D                Coelacanth  ag
B D                 Tetraodon  -g
B D                      Fugu  -g
       Yellowbelly pufferfish  -g
B D              Nile tilapia  tg
B D                    Medaka  ga
           Southern platyfish  tg
B D               Stickleback  -g
B D              Atlantic cod  gg
B D                 Zebrafish  ag
                  Spotted gar  ag
B D                 Orangutan  ==
B D                   Lamprey  --
B D                    Gibbon  NN
         Pundamilia nyererei  ==
                 Zebra mbuna  ==
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
B D                Budgerigar  ==
B D                       Cat  ==
             Star-nosed mole  ==
            Black flying-fox  ==
B D          White rhinoceros  --
        David's myotis (bat)  ==

Inserts between block 54 and 55 in window
B D                Tetraodon 3bp
B D                     Fugu 3bp
      Yellowbelly pufferfish 3bp
B D             Nile tilapia 922bp
B D                   Medaka 5bp
          Southern platyfish 915bp
B D              Stickleback 39bp

Alignment block 55 of 324 in window, 136131418 - 136131422, 5 bps 
B D                     Human  ggtgc
B D                     Chimp  ggtgc
B D                   Gorilla  ggtgc
B D                    Rhesus  ggtgc
B D       Crab-eating macaque  ggtgc
B D                    Baboon  ggtgc
                 Green monkey  ggtgc
B D                  Marmoset  gatgc
           Chinese tree shrew  agtag
       Lesser Egyptian jerboa  gatgc
                 Prairie vole  gatgc
B D                      Pika  ggtgc
B D                       Cow  ggtgt
B D                     Sheep  ggtgc
                Domestic goat  ggtgc
B D                     Horse  gatgg
B D                       Dog  ggtgc
B D                   Ferret   ggtgc
                 Weddell seal  ggtgc
                Big brown bat  ggtgc
B D                   Opossum  gatga
B D           Tasmanian devil  ggtga
B D                  Platypus  ggtgg
  D              Saker falcon  ggtgt
  D          Peregrine falcon  ggtgt
  D                    Parrot  ggtgt
  D             Scarlet macaw  ggtgt
  D               Rock pigeon  ggtgt
  D              Mallard duck  ggtgt
B D                   Chicken  ggtgt
B D                    Turkey  ggtgc
B D        American alligator  attgt
  D           Green seaturtle  ggtgt
B D            Painted turtle  ggtgt
  D  Chinese softshell turtle  ggtgt
  D    Spiny softshell turtle  ggtgt
B D             X. tropicalis  gatgt
B D                Coelacanth  ggtgt
B D              Atlantic cod  ---c-
B D                 Zebrafish  ---g-
                  Spotted gar  ---g-
B D                 Orangutan  =====
B D                   Lamprey  -----
B D                    Gibbon  NNNNN
B D               Stickleback  =====
          Southern platyfish  =====
      Yellowbelly pufferfish  =====
B D                      Fugu  =====
B D                 Tetraodon  =====
          Tibetan ground jay  -----
B D               Zebra finch  -----
  D    White-throated sparrow  -----
B D                    Medaka  =====
         Pundamilia nyererei  =====
                 Zebra mbuna  =====
       Burton's mouthbreeder  =====
         Princess of Burundi  =====
B D              Nile tilapia  =====
B D                Budgerigar  =====
B D       Medium ground finch  -----
B D                       Cat  =====
  D       Collared flycatcher  -----
             Star-nosed mole  =====
            Black flying-fox  =====
B D          White rhinoceros  -----
        David's myotis (bat)  =====

Inserts between block 55 and 56 in window
B D             Atlantic cod 4bp
B D                Zebrafish 4bp
                 Spotted gar 4bp

Alignment block 56 of 324 in window, 136131423 - 136131442, 20 bps 
B D                     Human  agggtgccgaacagc--ggagt
B D                     Chimp  agggtgccgaacagc--ggagt
B D                   Gorilla  agggtgccgaacagc--ggagt
B D                    Rhesus  agggtgccgaagagc--ggagt
B D       Crab-eating macaque  agggtgccgaagagc--ggagt
B D                    Baboon  agggtgccgaacagt--ggagt
                 Green monkey  agggtgccgaacagc--gaagc
B D                  Marmoset  agggtgccgaacagc--gggga
           Chinese tree shrew  agggtgccaaa-agc--gcaga
       Lesser Egyptian jerboa  agagttccgaagagt--tctga
                 Prairie vole  agggtaccgaagagt--gctga
B D                      Pika  agggtgccgaagagc--ggggt
B D                       Cow  agggtcccgaagagc--ggcgc
B D                     Sheep  agggtcccgaagagc--ggcgc
                Domestic goat  agggtcccgaagagc--ggcgc
B D                     Horse  agggtgccgaagagc--tggga
B D          White rhinoceros  aagctgccgaagagc--gggga
B D                       Dog  agggtgccgaagcgg--gggga
B D                   Ferret   agggtgccgaagagg--gggga
                 Weddell seal  agggtgccgaagagg--gggg-
                Big brown bat  agggtgccgaagagc--gggga
B D                   Opossum  agagtgccaaccaag--tcaga
B D           Tasmanian devil  atggcagctactaagtctccta
B D                  Platypus  agagtgccgaacaga--gggct
  D              Saker falcon  atggctgccactgta--tcacc
  D          Peregrine falcon  atggctgccactgta--tcacc
  D       Collared flycatcher  atggttgccaccagg--gcatc
  D    White-throated sparrow  atggtggccaccagg--gcatc
B D       Medium ground finch  atggtggccaccagg--gcgtc
B D               Zebra finch  atggtggccaccagg--gcatc
           Tibetan ground jay  atggttgccaccagg--gcatc
  D                    Parrot  atggctgctattgta--tcacc
  D             Scarlet macaw  atggctactactgta--tcacc
  D               Rock pigeon  atggctgctacaata--tcacc
  D              Mallard duck  atggctgctaccatg--tcacc
B D                   Chicken  atggctgccaccatg--tcacc
B D                    Turkey  atggctgctacaatg--tcact
B D        American alligator  cttg--actactgtg--tcaac
  D           Green seaturtle  atggctgctaccatc--tcacc
B D            Painted turtle  agtgtgccaaacaag--ttgct
  D  Chinese softshell turtle  agtgtgccaaacaag--ttgct
  D    Spiny softshell turtle  agtgtgccaaacaag--ttgct
B D             X. tropicalis  aacgtgccaaaaaca--tcact
B D                Coelacanth  attgctgctactagc--tcact
B D                 Tetraodon  agcagccccacagac--t----
B D                      Fugu  agcagcgccaccgac--t----
       Yellowbelly pufferfish  agcagcgccaccgac--t----
          Princess of Burundi  agtagagccacagag--t----
        Burton's mouthbreeder  agcagagccacagag--t----
                  Zebra mbuna  agcagagccacagag--t----
B D                    Medaka  agcacagccacagac--t----
B D               Stickleback  gtcacagccac-gag--t----
B D              Atlantic cod  agcagggccaccagg--t----
B D                 Zebrafish  atcacacctataaga--t----
                  Spotted gar  attgcagccaccagg--t----
B D                   Lamprey  ------gccgaaagc-------
B D                 Orangutan  ======================
B D                    Gibbon  NNNNNNNNNNNNNNNNNNNNNN
          Southern platyfish  ======================
         Pundamilia nyererei  ======================
B D              Nile tilapia  ======================
B D                Budgerigar  ======================
B D                       Cat  ======================
             Star-nosed mole  ======================
            Black flying-fox  ======================
        David's myotis (bat)  ======================

Inserts between block 56 and 57 in window
B D                Tetraodon 4bp
B D                     Fugu 4bp
      Yellowbelly pufferfish 4bp
         Princess of Burundi 4bp
       Burton's mouthbreeder 4bp
                 Zebra mbuna 4bp
B D                   Medaka 4bp
B D              Stickleback 5bp
B D             Atlantic cod 4bp
B D                Zebrafish 4bp
                 Spotted gar 4bp

Alignment block 57 of 324 in window, 136131443 - 136131448, 6 bps 
B D                     Human  -----caggat
B D                     Chimp  -----caggat
B D                   Gorilla  -----caggat
B D                    Rhesus  -----caggat
B D       Crab-eating macaque  -----caggat
B D                    Baboon  -----caggat
                 Green monkey  -----caggat
B D                  Marmoset  -----caggat
           Chinese tree shrew  -----cagggt
       Lesser Egyptian jerboa  -----caggat
                 Prairie vole  -----gagaat
B D                      Pika  -----caggat
B D                       Cow  -----caggat
B D                     Sheep  -----caggat
                Domestic goat  -----caggat
B D                     Horse  -----caggat
B D          White rhinoceros  -----caggat
B D                       Dog  -----caggat
B D                   Ferret   -----caggat
                 Weddell seal  -----cagaat
                Big brown bat  -----caggat
B D                   Opossum  -----aagcat
B D           Tasmanian devil  -----aagtct
B D                  Platypus  -----cagaat
  D              Saker falcon  -----cagggt
  D          Peregrine falcon  -----cagggt
  D       Collared flycatcher  -----gatgat
  D    White-throated sparrow  -----gatgat
B D       Medium ground finch  -----gatgat
B D               Zebra finch  -----gatgat
           Tibetan ground jay  -----aatgat
  D                    Parrot  -----cagggt
  D             Scarlet macaw  -----cagggt
  D               Rock pigeon  -----tagggt
  D              Mallard duck  -----cagggt
B D                   Chicken  -----gagggt
B D                    Turkey  -----gagggt
B D        American alligator  -----aat---
  D           Green seaturtle  -----cagagt
B D            Painted turtle  -----caggat
  D  Chinese softshell turtle  -----caggat
  D    Spiny softshell turtle  -----caggat
B D             X. tropicalis  -----tagtat
B D                Coelacanth  -----taatgc
B D                 Tetraodon  -----cagagc
B D                      Fugu  -----cagagc
       Yellowbelly pufferfish  -----cagagc
B D              Nile tilapia  -----cagcga
          Princess of Burundi  -----cagagc
        Burton's mouthbreeder  -----cagagc
                  Zebra mbuna  -----cagagc
          Pundamilia nyererei  -----cagcga
B D                    Medaka  -----gagagc
B D               Stickleback  -----cagcga
B D              Atlantic cod  -----cagagc
B D                 Zebrafish  -----caaagt
                  Spotted gar  -----aaacac
B D                   Lamprey  ctcccc-----
B D                 Orangutan  ===========
B D                    Gibbon  NNNNNNNNNNN
          Southern platyfish  ===========
B D                Budgerigar  ===========
B D                       Cat  ===========
             Star-nosed mole  ===========
            Black flying-fox  ===========
        David's myotis (bat)  ===========

Inserts between block 57 and 58 in window
  D             Saker falcon 159bp
  D         Peregrine falcon 159bp

Alignment block 58 of 324 in window, 136131449 - 136131462, 14 bps 
B D                     Human  ---ctccacgcc--------cacgt
B D                     Chimp  ---ctccacgcc--------cacgt
B D                   Gorilla  ---ctccacgcc--------cacgt
B D                    Rhesus  ---ctccacgcc--------cacgt
B D       Crab-eating macaque  ---ctccacgcc--------cacgt
B D                    Baboon  ---ctccacgcc--------cacgt
                 Green monkey  ---ctccacgcc--------cacgt
B D                  Marmoset  ---ctccacgcc--------cacgt
           Chinese tree shrew  ---ctccacacc--------cacat
       Lesser Egyptian jerboa  ---ctccacacc--------cacgt
                 Prairie vole  ---ctccacacc--------cacgt
B D                      Pika  ---ctctacgcc--------cacgt
B D                       Cow  ---ctccacgcc--------cacgt
B D                     Sheep  ---ctccacgcc--------cacgt
                Domestic goat  ---ctccacgcc--------cacgt
B D                     Horse  ---ctctacgcc--------cacgt
B D          White rhinoceros  ---ctccacgcc--------cacgt
B D                       Dog  ---ctccacgcc--------cacgt
B D                   Ferret   ---ctccacgcc--------cacct
                 Weddell seal  ---ctccacccc--------cccgt
                Big brown bat  ---ctccacgcc--------cacgt
B D                   Opossum  ---ctctacccc--------gacat
B D           Tasmanian devil  ---cagcacccc--------aag--
B D                  Platypus  ---ctccacccc--------gacgt
  D       Collared flycatcher  ---ctccaccccgatgtgtgccagg
  D    White-throated sparrow  ---ctccacgccaatatgtgccagg
B D       Medium ground finch  ---ctccacgccgatgtgtgccagg
B D               Zebra finch  ---ctccacgccaatgtgtgccagg
           Tibetan ground jay  ---ctccacaccgatgtctgccagg
  D                    Parrot  ---ctcagaccc--------ccagg
  D             Scarlet macaw  ---ctcagaccc--------ccagg
  D               Rock pigeon  ---ctcaggccc--------ccagg
  D              Mallard duck  ---ctcaggccc--------ccagg
B D                   Chicken  ---ctcagcccc--------ccagg
B D                    Turkey  ---ctcagcccc--------ccagg
B D        American alligator  ---ttccacctcaatatgctcaaag
  D           Green seaturtle  ---ctccgcccc--------ccatg
B D            Painted turtle  ---ctccactcc--------aactt
  D  Chinese softshell turtle  ---ttctactcc--------aacta
  D    Spiny softshell turtle  ---ttctactcc--------aacta
B D             X. tropicalis  ---ttccactcc--------aactt
B D                Coelacanth  ---ttctatgcc--------aaagt
B D                 Tetraodon  ---ctctggacc--------aaacc
B D                      Fugu  ---ctccggacc--------gaacc
       Yellowbelly pufferfish  ---ctccggacc--------gaacc
B D              Nile tilapia  ---ctcggcccc--------ccagc
          Princess of Burundi  ---ctctgagcc--------aaatc
        Burton's mouthbreeder  ---ctctgagcc--------aaatc
                  Zebra mbuna  ---ctctgagcc--------aaatc
          Pundamilia nyererei  ---ctcggcccc--------ccagc
B D                    Medaka  ---ctcagagcc--------gaagc
           Southern platyfish  ---ctcggttcc--------ccatc
B D               Stickleback  ---ctcgctccc--------ccagc
B D              Atlantic cod  ---ctccgagcc--------gaacc
B D                 Zebrafish  ---ctctgctcc--------ccagc
                  Spotted gar  ---ctccgcccc--------ccagc
B D                   Lamprey  cccccccacccc--------ct---
B D                 Orangutan  =========================
B D                    Gibbon  NNNNNNNNNNNNNNNNNNNNNNNNN
B D                Budgerigar  =========================
  D          Peregrine falcon  =========================
  D              Saker falcon  =========================
B D                       Cat  =========================
             Star-nosed mole  =========================
            Black flying-fox  =========================
        David's myotis (bat)  =========================

Alignment block 59 of 324 in window, 136131463 - 136131511, 49 bps 
B D                     Human  ggtcgcggaactccatgtccacgtccacgcacaccaggtaatccacctc
B D                     Chimp  ggtcgcggaactccatgtccacgtccacgcacaccaggtaatccacctc
B D                   Gorilla  ggtcgcggaactccatgtccacgtccacgcacaccaggtaatccacctc
B D                    Rhesus  ggtcgcggaactccatgtccacgtccgcgcacaccaggtaatccacctc
B D       Crab-eating macaque  ggtcgcggaactccatgtccacgtccgcgcacaccaggtaatccacctc
B D                    Baboon  ggtcgcggaactccatgtccacgtccgcgcacaccaggtaatccacctc
                 Green monkey  ggtcgcggaactccatgtccacgtccacgcacaccaggtaatccacctc
B D                  Marmoset  ggtcactgaacttcatgtccacgtccgtgcacaccaggtaatccacctc
           Chinese tree shrew  ggtccaggag---catgtccacgtcggtgtacaccaagtaatccacctc
       Lesser Egyptian jerboa  ggtcacgaaacttcatgtccacgtcggcacacaccaggtaatccacctc
                 Prairie vole  ggtcttggaacttcatgtccacatctgcacacaccaggtaatccacctc
B D                      Pika  ggtccctgaactgcatgtccacgtcggcgcacaccaggtagtccacctc
B D                       Cow  ggtcgctgaacttcatgtccacgtacaggcacaccaggtagtccacctc
B D                     Sheep  ggtcgctgaacttcatgtccacgtccaggcacaccaggtagtccacctc
                Domestic goat  ggtcgctgaacttcatgtccacgtccaggcacaccaggtagtccacctc
B D                     Horse  ggtcacggaacttcatgtccacgtccgcgcacacgaggaagtccacctc
B D          White rhinoceros  ggtcgcggaacctcatgtccacgtccgcgcacacgaggaagtccacctc
B D                       Dog  gatcgcagaacttcatgtccacatccatgcacaccaggtagtccacctc
B D                   Ferret   ggtcactgaacttcatgtccacgtccatgcacaccaggtagtccacctc
                 Weddell seal  ggtcgctgaacttcatgtgcac-tacacgcacaccaggtagtccaactt
                Big brown bat  ggtcgcggaagcgcatgtccacgtccacgcacatgagaaagtccacctc
B D                   Opossum  gatcattaaacttcatgtctacatccagacatacgaggtaatctacatc
B D           Tasmanian devil  gattccagaacaccatgtctatatctagacagtagagatagtctacctc
B D                   Wallaby  gatcactaaacttcatgtctacatccatacataccaggtagtctacctc
B D                  Platypus  ggtcgctgaacttcatatctacgtcagcacacacgagatagtctacttc
  D       Collared flycatcher  agctg--------cacgttgatgtccatggagtacagataatccacctc
  D    White-throated sparrow  agctg--------gacattgatatccacggagtacagataatccacctc
B D       Medium ground finch  agctg--------gacgttgatatccacggagtacagataatccacctc
B D               Zebra finch  agctg--------gacattgatgtccagggagtacagatagtccacctc
           Tibetan ground jay  agctg--------gacatcaatgtccatggagtacagatagtccacctc
  D                    Parrot  cattgtaaaacaccatgccaatgttcaggcagaagaagtagtccacctc
  D             Scarlet macaw  cattgtaaaacactatgtcaatgttcaggcagaagaggtagtccacctc
  D               Rock pigeon  tgttgtagaacaccatgtcaatgtccaggcagaagaggtagtccacctc
  D              Mallard duck  cgttgcagaacaccatgtcaacgtggaggcagaagaggtagtccacctc
B D                   Chicken  cattgtggaacaccatgtcaatatccaggcagaagaggtagtccacctc
B D                    Turkey  cattgtggaacaccatgtcaatatccagacagaagaggtagtccacctc
B D        American alligator  agctt--------gacatccatgtccacaaagtaaagagagttcacttc
  D           Green seaturtle  ggttgtgaaacaccatgtcgatgtccaggcagaagaggtagttcacctc
B D            Painted turtle  ggtcattaaacttcatgtctacatccacacacactaggtagctgacctc
  D  Chinese softshell turtle  agtcattaaacctcatgtctacgtcaacacacacaaggtagtcgacctc
  D    Spiny softshell turtle  ggtcattaaacctcatgtctacgtcaacacacacaaggtagtcgacctc
B D             X. tropicalis  catcactaaattgcatatctacatcgacacagaccaagtagtccacctc
B D                Coelacanth  gattctggaactgcatatcaatgtccagacagaaaaggtagtccacttc
B D                 Tetraodon  tgccagtaaacacctggtccacgtccaagcagaacacatactggcagtg
B D                      Fugu  ttccggaaaacacctggtccacatcgaagcagaagacgtacttggattg
       Yellowbelly pufferfish  ttccggaaaacacctggtccacatcgaagcagaagacgtacttggattg
B D              Nile tilapia  gaccgtggaacttggagtcgacgtccagacagaagatgtagtcggcgcg
          Princess of Burundi  tgccagtgaacacctgatctacatcaaagcagaagacatgcgtggagtg
        Burton's mouthbreeder  tcccagtgaacacctgatctacatcgaagcagaagacatgcgtggagtg
                  Zebra mbuna  tcccagtgaacacctgatctacatcgaagcagaagacatgcgtggagtg
          Pundamilia nyererei  gaccgtggaactttgagtcgacgtccagacagaagatgtagtcggcgcg
B D                    Medaka  gccccttaaattcctgatctacatccaaacaaaagacataattgaagtt
           Southern platyfish  gactgtgaaactttgagtcaacatccaaacagaagatgtagtccacatc
B D               Stickleback  ggccgtggaactgggagtccacgtccaggcaaaagatgtagtttctgtt
B D              Atlantic cod  tggccgtgaacacctggtccacgtccatgcagaagacgtgggtgctgct
B D                 Zebrafish  ggccgtagaactttgtatccacatcaaggctgaaaacatagtctgcttc
                  Spotted gar  ggctgtgaaagagcatgtccacatctaggcagtaaatgtactgggcttc
B D                   Lamprey  caccttggaactccatgtcgacatcgaagcagaagacgtattgagcctc
B D                 Orangutan  =================================================
B D                    Gibbon  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                Budgerigar  =================================================
  D          Peregrine falcon  =================================================
  D              Saker falcon  =================================================
B D                       Cat  =================================================
             Star-nosed mole  =================================================
            Black flying-fox  =================================================
        David's myotis (bat)  =================================================

Alignment block 60 of 324 in window, 136131512 - 136131513, 2 bps 
B D                     Human  gc
B D                     Chimp  gc
B D                   Gorilla  gc
B D                    Rhesus  gc
B D       Crab-eating macaque  gc
B D                    Baboon  gc
                 Green monkey  gc
B D                  Marmoset  gc
           Chinese tree shrew  at
       Lesser Egyptian jerboa  gt
                 Prairie vole  ct
B D                      Pika  gt
B D                       Cow  gc
B D                     Sheep  gt
                Domestic goat  gt
B D                     Horse  gc
B D          White rhinoceros  gc
B D                       Dog  ac
B D                   Ferret   gc
                 Weddell seal  gt
                Big brown bat  cc
B D                   Opossum  ct
B D                   Wallaby  cc
B D                  Platypus  cc
  D       Collared flycatcher  gt
  D    White-throated sparrow  gt
B D       Medium ground finch  gt
B D               Zebra finch  gt
           Tibetan ground jay  gt
  D                    Parrot  tt
  D             Scarlet macaw  tt
  D               Rock pigeon  ct
  D              Mallard duck  c-
B D                   Chicken  cc
B D                    Turkey  cc
B D        American alligator  at
  D           Green seaturtle  -c
B D            Painted turtle  at
  D  Chinese softshell turtle  at
  D    Spiny softshell turtle  at
B D             X. tropicalis  -t
B D                Coelacanth  -t
B D                 Tetraodon  gt
B D                      Fugu  gt
       Yellowbelly pufferfish  gt
B