Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 941 in window, 56745427 - 56745442, 16 bps 
B D                     Human  aaacaaaaaaa------accaa
B D                     Chimp  caaaaaaaaaa------ccaaa
B D                   Gorilla  aaacaaaaaaaaaaaaccaaaa
B D                 Orangutan  aaaaaacaaaa------aacaa
B D                    Gibbon  -----------------aacaa
B D                    Rhesus  --acaacaaca------acaac
B D              Green monkey  --acaacaa-a------acaac
B D                  Marmoset  aagcaaagcaa------aacaa
B D           Squirrel monkey  aagcaaaacaa------aacaa
B D                  Hedgehog  ======================
B D                Guinea pig  ======================
B D                      Pika  ======================
B D                    Rabbit  ======================
B D                   Lamprey  ======================
B D                Coelacanth  ======================
B D                     Shrew  ======================
              Golden hamster  ======================
B D                    Baboon  ======================
B D       Crab-eating macaque  NNNNNNNNNNNNNNNNNNNNNN
            Brush-tailed rat  ======================
B D              Atlantic cod  ======================
                 Spotted gar  ======================
B D               Stickleback  ======================
          Southern platyfish  ======================
      Yellowbelly pufferfish  ======================
B D                      Fugu  ======================
B D                    Turkey  ======================
B D                   Chicken  ======================
  D              Mallard duck  ======================
          Tibetan ground jay  ======================
B D               Zebra finch  ======================
B D           Tasmanian devil  ======================
    Mexican tetra (cavefish)  ======================
B D                 Zebrafish  ======================
B D                    Medaka  ======================
         Pundamilia nyererei  ======================
                 Zebra mbuna  ======================
       Burton's mouthbreeder  ======================
         Princess of Burundi  ======================
B D              Nile tilapia  ======================
B D             X. tropicalis  ======================
  D            Painted turtle  ======================
  D           Green seaturtle  ======================
B D        American alligator  ======================
  D             Scarlet macaw  ======================
B D                Budgerigar  ======================
B D                   Opossum  ======================
                  Chinchilla  ======================
B D            Naked mole-rat  ======================
      Lesser Egyptian jerboa  ======================
  D               Rock pigeon  ======================
  D       Collared flycatcher  NNNNNNNNNNNNNNNNNNNNNN
B D       Medium ground finch  ======================
B D                    Lizard  ======================
  D          Peregrine falcon  ======================
  D              Saker falcon  ======================
  D                    Parrot  ======================
            Cape golden mole  ======================
          Chinese tree shrew  ======================
         Cape elephant shrew  ======================
B D                  Platypus  ======================
B D                   Wallaby  ======================
B D                   Manatee  ======================
B D           Chinese hamster  ======================
                Prairie vole  ======================
                    Aardvark  ======================
B D                  Elephant  ======================
B D                    Tenrec  ======================
B D                       Cat  ======================
B D                   Megabat  ======================
B D                  Bushbaby  ======================
B D                       Pig  ======================
  D  Chinese softshell turtle  ======================
B D                   Ferret   ======================
B D                   Dolphin  ======================
B D                       Rat  ======================
B D                     Mouse  ======================
B D                     Panda  ======================
               Domestic goat  ----------------------
B D                     Sheep  ----------------------
            Tibetan antelope  ----------------------
             Star-nosed mole  ======================
              Bactrian camel  ======================
B D                    Alpaca  ======================
              Pacific walrus  ======================
            Black flying-fox  ======================
B D          White rhinoceros  ======================
B D                     Horse  ======================
B D                  Squirrel  ======================
B D                 Armadillo  ======================
                Weddell seal  ======================
        David's myotis (bat)  ======================
               Big brown bat  ======================
  D          Little brown bat  ======================
B D                       Dog  ======================
B D                       Cow  ======================
                Killer whale  ======================

Alignment block 2 of 941 in window, 56745443 - 56745450, 8 bps 
B D                     Human  aaaaacaa
B D                     Chimp  aaaaacaa
B D                   Gorilla  aaaaacaa
B D                 Orangutan  accaacca
B D                    Gibbon  acaaacaa
B D                    Rhesus  aacaacaa
B D              Green monkey  aacaacaa
B D                  Marmoset  aacaaaac
B D           Squirrel monkey  aacaaaac
B D                   Ferret   aaatatag
B D                  Hedgehog  ========
B D                Guinea pig  ========
B D                      Pika  ========
B D                    Rabbit  ========
B D                   Lamprey  ========
B D                Coelacanth  ========
B D                     Shrew  ========
              Golden hamster  ========
B D                    Baboon  ========
B D       Crab-eating macaque  NNNNNNNN
            Brush-tailed rat  ========
B D              Atlantic cod  ========
                 Spotted gar  ========
B D               Stickleback  ========
          Southern platyfish  ========
      Yellowbelly pufferfish  ========
B D                      Fugu  ========
B D                    Turkey  ========
B D                   Chicken  ========
  D              Mallard duck  ========
          Tibetan ground jay  ========
B D               Zebra finch  ========
B D           Tasmanian devil  ========
    Mexican tetra (cavefish)  ========
B D                 Zebrafish  ========
B D                    Medaka  ========
         Pundamilia nyererei  ========
                 Zebra mbuna  ========
       Burton's mouthbreeder  ========
         Princess of Burundi  ========
B D              Nile tilapia  ========
B D             X. tropicalis  ========
  D            Painted turtle  ========
  D           Green seaturtle  ========
B D        American alligator  ========
  D             Scarlet macaw  ========
B D                Budgerigar  ========
B D                   Opossum  ========
                  Chinchilla  ========
B D            Naked mole-rat  ========
      Lesser Egyptian jerboa  ========
  D               Rock pigeon  ========
  D       Collared flycatcher  NNNNNNNN
B D       Medium ground finch  ========
B D                    Lizard  ========
  D          Peregrine falcon  ========
  D              Saker falcon  ========
  D                    Parrot  ========
            Cape golden mole  ========
          Chinese tree shrew  ========
         Cape elephant shrew  ========
B D                  Platypus  ========
B D                   Wallaby  ========
B D                   Manatee  ========
B D           Chinese hamster  ========
                Prairie vole  ========
                    Aardvark  ========
B D                  Elephant  ========
B D                    Tenrec  ========
B D                       Cat  ========
B D                   Megabat  ========
B D                  Bushbaby  ========
B D                       Pig  ========
  D  Chinese softshell turtle  ========
B D                   Dolphin  ========
B D                       Rat  ========
B D                     Mouse  ========
B D                     Panda  ========
               Domestic goat  --------
B D                     Sheep  --------
            Tibetan antelope  --------
             Star-nosed mole  ========
              Bactrian camel  ========
B D                    Alpaca  ========
              Pacific walrus  ========
            Black flying-fox  ========
B D          White rhinoceros  ========
B D                     Horse  ========
B D                  Squirrel  ========
B D                 Armadillo  ========
                Weddell seal  ========
        David's myotis (bat)  ========
               Big brown bat  ========
  D          Little brown bat  ========
B D                       Dog  ========
B D                       Cow  ========
                Killer whale  ========

Alignment block 3 of 941 in window, 56745451 - 56745459, 9 bps 
B D                     Human  accaaaacc---
B D                     Chimp  accaaaacc---
B D                   Gorilla  accaaaacc---
B D                 Orangutan  accaaaacc---
B D                    Gibbon  a--aaaacc---
B D                    Rhesus  aacaaaatc---
B D              Green monkey  aacaaaatc---
B D                  Marmoset  acccaaacc---
B D           Squirrel monkey  acccaaacc---
B D            Naked mole-rat  accaaaaaa---
B D                   Ferret   -attaaattgtc
B D                  Hedgehog  ============
B D                Guinea pig  ============
B D                      Pika  ============
B D                    Rabbit  ============
B D                   Lamprey  ============
B D                Coelacanth  ============
B D                     Shrew  ============
              Golden hamster  ============
B D                    Baboon  ============
B D       Crab-eating macaque  NNNNNNNNNNNN
            Brush-tailed rat  ============
B D              Atlantic cod  ============
                 Spotted gar  ============
B D               Stickleback  ============
          Southern platyfish  ============
      Yellowbelly pufferfish  ============
B D                      Fugu  ============
B D                    Turkey  ============
B D                   Chicken  ============
  D              Mallard duck  ============
          Tibetan ground jay  ============
B D               Zebra finch  ============
B D           Tasmanian devil  ============
    Mexican tetra (cavefish)  ============
B D                 Zebrafish  ============
B D                    Medaka  ============
         Pundamilia nyererei  ============
                 Zebra mbuna  ============
       Burton's mouthbreeder  ============
         Princess of Burundi  ============
B D              Nile tilapia  ============
B D             X. tropicalis  ============
  D            Painted turtle  ============
  D           Green seaturtle  ============
B D        American alligator  ============
  D             Scarlet macaw  ============
B D                Budgerigar  ============
B D                   Opossum  ============
                  Chinchilla  ============
      Lesser Egyptian jerboa  ============
  D               Rock pigeon  ============
  D       Collared flycatcher  NNNNNNNNNNNN
B D       Medium ground finch  ============
B D                    Lizard  ============
  D          Peregrine falcon  ============
  D              Saker falcon  ============
  D                    Parrot  ============
            Cape golden mole  ============
          Chinese tree shrew  ============
         Cape elephant shrew  ============
B D                  Platypus  ============
B D                   Wallaby  ============
B D                   Manatee  ============
B D           Chinese hamster  ============
                Prairie vole  ============
                    Aardvark  ============
B D                  Elephant  ============
B D                    Tenrec  ============
B D                       Cat  ============
B D                   Megabat  ============
B D                  Bushbaby  ============
B D                       Pig  ============
  D  Chinese softshell turtle  ============
B D                   Dolphin  ============
B D                       Rat  ============
B D                     Mouse  ============
B D                     Panda  ============
               Domestic goat  ------------
B D                     Sheep  ------------
            Tibetan antelope  ------------
             Star-nosed mole  ============
              Bactrian camel  ============
B D                    Alpaca  ============
              Pacific walrus  ============
            Black flying-fox  ============
B D          White rhinoceros  ============
B D                     Horse  ============
B D                  Squirrel  ============
B D                 Armadillo  ============
                Weddell seal  ============
        David's myotis (bat)  ============
               Big brown bat  ============
  D          Little brown bat  ============
B D                       Dog  ============
B D                       Cow  ============
                Killer whale  ============

Alignment block 4 of 941 in window, 56745460 - 56745483, 24 bps 
B D                     Human  aaaaccaaa-----ctttaacatgttcta
B D                     Chimp  aaaaccaaa-----ctttaacatgttcta
B D                   Gorilla  aaaaccaaa-----ctttaacatgttcta
B D                 Orangutan  aaaaccaaa-----ctttaacatgttcta
B D                    Gibbon  aaaaccaaa-----ctttaacatgttcta
B D                    Rhesus  aaaaacaaa-----ctttaacatgttcta
B D              Green monkey  aaaaccaaa-----ctttaacatgttcta
B D                  Marmoset  aaaaccaaa-----ctttaatatgttcta
B D           Squirrel monkey  aaaaccaaa-----ctttagtatgttcta
B D            Naked mole-rat  aaaaaaaaa---ttctttattgtatttca
             Tibetan antelope  agaatcaaaattttctttaatgtgttcta
B D                     Sheep  agaatcaaaattttctctaatgtattcta
                Domestic goat  agaatcaaaattttctttaatgtattcta
B D                   Ferret   aaaatatagaatt----taat-tctttta
B D                  Hedgehog  =============================
B D                Guinea pig  =============================
B D                      Pika  =============================
B D                    Rabbit  =============================
B D                   Lamprey  =============================
B D                Coelacanth  =============================
B D                     Shrew  =============================
              Golden hamster  =============================
B D                    Baboon  =============================
B D       Crab-eating macaque  NNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            Brush-tailed rat  =============================
B D              Atlantic cod  =============================
                 Spotted gar  =============================
B D               Stickleback  =============================
          Southern platyfish  =============================
      Yellowbelly pufferfish  =============================
B D                      Fugu  =============================
B D                    Turkey  =============================
B D                   Chicken  =============================
  D              Mallard duck  =============================
          Tibetan ground jay  =============================
B D               Zebra finch  =============================
B D           Tasmanian devil  =============================
    Mexican tetra (cavefish)  =============================
B D                 Zebrafish  =============================
B D                    Medaka  =============================
         Pundamilia nyererei  =============================
                 Zebra mbuna  =============================
       Burton's mouthbreeder  =============================
         Princess of Burundi  =============================
B D              Nile tilapia  =============================
B D             X. tropicalis  =============================
  D            Painted turtle  =============================
  D           Green seaturtle  =============================
B D        American alligator  =============================
  D             Scarlet macaw  =============================
B D                Budgerigar  =============================
B D                   Opossum  =============================
                  Chinchilla  =============================
      Lesser Egyptian jerboa  =============================
  D               Rock pigeon  =============================
  D       Collared flycatcher  NNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D       Medium ground finch  =============================
B D                    Lizard  =============================
  D          Peregrine falcon  =============================
  D              Saker falcon  =============================
  D                    Parrot  =============================
            Cape golden mole  =============================
          Chinese tree shrew  =============================
         Cape elephant shrew  =============================
B D                  Platypus  =============================
B D                   Wallaby  =============================
B D                   Manatee  =============================
B D           Chinese hamster  =============================
                Prairie vole  =============================
                    Aardvark  =============================
B D                  Elephant  =============================
B D                    Tenrec  =============================
B D                       Cat  =============================
B D                   Megabat  =============================
B D                  Bushbaby  =============================
B D                       Pig  =============================
  D  Chinese softshell turtle  =============================
B D                   Dolphin  =============================
B D                       Rat  =============================
B D                     Mouse  =============================
B D                     Panda  =============================
             Star-nosed mole  =============================
              Bactrian camel  =============================
B D                    Alpaca  =============================
              Pacific walrus  =============================
            Black flying-fox  =============================
B D          White rhinoceros  =============================
B D                     Horse  =============================
B D                  Squirrel  =============================
B D                 Armadillo  =============================
                Weddell seal  =============================
        David's myotis (bat)  =============================
               Big brown bat  =============================
  D          Little brown bat  =============================
B D                       Dog  =============================
B D                       Cow  =============================
                Killer whale  =============================

Inserts between block 4 and 5 in window
B D           Naked mole-rat 1bp

Alignment block 5 of 941 in window, 56745484 - 56745486, 3 bps 
B D                     Human  tta
B D                     Chimp  tta
B D                   Gorilla  tta
B D                 Orangutan  tta
B D                    Gibbon  tta
B D                    Rhesus  tta
B D              Green monkey  tta
B D                  Marmoset  tta
B D           Squirrel monkey  tta
B D                  Squirrel  tta
B D            Naked mole-rat  tta
             Tibetan antelope  --a
B D                     Sheep  --a
                Domestic goat  --a
B D                   Ferret   --a
B D                  Hedgehog  ===
B D                Guinea pig  ===
B D                      Pika  ===
B D                    Rabbit  ===
B D                   Lamprey  ===
B D                Coelacanth  ===
B D                     Shrew  ===
              Golden hamster  ===
B D                    Baboon  ===
B D       Crab-eating macaque  NNN
            Brush-tailed rat  ===
B D              Atlantic cod  ===
                 Spotted gar  ===
B D               Stickleback  ===
          Southern platyfish  ===
      Yellowbelly pufferfish  ===
B D                      Fugu  ===
B D                    Turkey  ===
B D                   Chicken  ===
  D              Mallard duck  ===
          Tibetan ground jay  ===
B D               Zebra finch  ===
B D           Tasmanian devil  ===
    Mexican tetra (cavefish)  ===
B D                 Zebrafish  ===
B D                    Medaka  ===
         Pundamilia nyererei  ===
                 Zebra mbuna  ===
       Burton's mouthbreeder  ===
         Princess of Burundi  ===
B D              Nile tilapia  ===
B D             X. tropicalis  ===
  D            Painted turtle  ===
  D           Green seaturtle  ===
B D        American alligator  ===
  D             Scarlet macaw  ===
B D                Budgerigar  ===
B D                   Opossum  ===
                  Chinchilla  ===
      Lesser Egyptian jerboa  ===
  D               Rock pigeon  ===
  D       Collared flycatcher  NNN
B D       Medium ground finch  ===
B D                    Lizard  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
  D                    Parrot  ===
            Cape golden mole  ===
          Chinese tree shrew  ===
         Cape elephant shrew  ===
B D                  Platypus  ===
B D                   Wallaby  ===
B D                   Manatee  ===
B D           Chinese hamster  ===
                Prairie vole  ===
                    Aardvark  ===
B D                  Elephant  ===
B D                    Tenrec  ===
B D                       Cat  ===
B D                   Megabat  ===
B D                  Bushbaby  ===
B D                       Pig  ===
  D  Chinese softshell turtle  ===
B D                   Dolphin  ===
B D                       Rat  ===
B D                     Mouse  ===
B D                     Panda  ===
             Star-nosed mole  ===
              Bactrian camel  ===
B D                    Alpaca  ===
              Pacific walrus  ===
            Black flying-fox  ===
B D          White rhinoceros  ===
B D                     Horse  ===
B D                 Armadillo  ===
                Weddell seal  ===
        David's myotis (bat)  ===
               Big brown bat  ===
  D          Little brown bat  ===
B D                       Dog  ===
B D                       Cow  ===
                Killer whale  ===

Alignment block 6 of 941 in window, 56745487 - 56745492, 6 bps 
B D                     Human  t-tttat
B D                     Chimp  t-tttat
B D                   Gorilla  t-tttat
B D                 Orangutan  t-tttat
B D                    Gibbon  t-tttat
B D                    Rhesus  t-tttat
B D              Green monkey  t-tttac
B D                  Marmoset  t-tttac
B D           Squirrel monkey  t-tttat
B D                  Squirrel  c-ttgac
B D            Naked mole-rat  catttaa
             Tibetan antelope  a-gatat
B D                     Sheep  a-gatat
                Domestic goat  a-gatat
B D                   Ferret   t-tatgt
B D                   Manatee  t-tttgt
B D                  Hedgehog  =======
B D                Guinea pig  =======
B D                      Pika  =======
B D                    Rabbit  =======
B D                   Lamprey  =======
B D                Coelacanth  =======
B D                     Shrew  =======
              Golden hamster  =======
B D                    Baboon  =======
B D       Crab-eating macaque  NNNNNNN
            Brush-tailed rat  =======
B D              Atlantic cod  =======
                 Spotted gar  =======
B D               Stickleback  =======
          Southern platyfish  =======
      Yellowbelly pufferfish  =======
B D                      Fugu  =======
B D                    Turkey  =======
B D                   Chicken  =======
  D              Mallard duck  =======
          Tibetan ground jay  =======
B D               Zebra finch  =======
B D           Tasmanian devil  =======
    Mexican tetra (cavefish)  =======
B D                 Zebrafish  =======
B D                    Medaka  =======
         Pundamilia nyererei  =======
                 Zebra mbuna  =======
       Burton's mouthbreeder  =======
         Princess of Burundi  =======
B D              Nile tilapia  =======
B D             X. tropicalis  =======
  D            Painted turtle  =======
  D           Green seaturtle  =======
B D        American alligator  =======
  D             Scarlet macaw  =======
B D                Budgerigar  =======
B D                   Opossum  =======
                  Chinchilla  =======
      Lesser Egyptian jerboa  =======
  D               Rock pigeon  =======
  D       Collared flycatcher  NNNNNNN
B D       Medium ground finch  =======
B D                    Lizard  =======
  D          Peregrine falcon  =======
  D              Saker falcon  =======
  D                    Parrot  =======
            Cape golden mole  =======
          Chinese tree shrew  =======
         Cape elephant shrew  =======
B D                  Platypus  =======
B D                   Wallaby  =======
B D           Chinese hamster  =======
                Prairie vole  =======
                    Aardvark  =======
B D                  Elephant  =======
B D                    Tenrec  =======
B D                       Cat  =======
B D                   Megabat  =======
B D                  Bushbaby  =======
B D                       Pig  =======
  D  Chinese softshell turtle  =======
B D                   Dolphin  =======
B D                       Rat  =======
B D                     Mouse  =======
B D                     Panda  =======
             Star-nosed mole  =======
              Bactrian camel  =======
B D                    Alpaca  =======
              Pacific walrus  =======
            Black flying-fox  =======
B D          White rhinoceros  =======
B D                     Horse  =======
B D                 Armadillo  =======
                Weddell seal  =======
        David's myotis (bat)  =======
               Big brown bat  =======
  D          Little brown bat  =======
B D                       Dog  =======
B D                       Cow  =======
                Killer whale  =======

Inserts between block 6 and 7 in window
            Tibetan antelope 15bp
B D                    Sheep 15bp
               Domestic goat 15bp
B D                  Ferret  20bp

Alignment block 7 of 941 in window, 56745493 - 56745496, 4 bps 
B D                     Human  atat--
B D                     Chimp  atat--
B D                   Gorilla  atat--
B D                 Orangutan  atat--
B D                    Gibbon  atat--
B D                    Rhesus  atac--
B D              Green monkey  atat--
B D                  Marmoset  atgt--
B D           Squirrel monkey  atgt--
B D                  Squirrel  aaat--
B D            Naked mole-rat  aagt--
             Tibetan antelope  aaag--
B D                     Sheep  aaag--
                Domestic goat  aaag--
B D                       Dog  gaac--
B D                   Ferret   gaac--
B D                   Manatee  --gttt
B D                  Hedgehog  ======
B D                Guinea pig  ======
B D                      Pika  ======
B D                    Rabbit  ======
B D                   Lamprey  ======
B D                Coelacanth  ======
B D                     Shrew  ======
              Golden hamster  ======
B D                    Baboon  ======
B D       Crab-eating macaque  NNNNNN
            Brush-tailed rat  ======
B D              Atlantic cod  ======
                 Spotted gar  ======
B D               Stickleback  ======
          Southern platyfish  ======
      Yellowbelly pufferfish  ======
B D                      Fugu  ======
B D                    Turkey  ======
B D                   Chicken  ======
  D              Mallard duck  ======
          Tibetan ground jay  ======
B D               Zebra finch  ======
B D           Tasmanian devil  ======
    Mexican tetra (cavefish)  ======
B D                 Zebrafish  ======
B D                    Medaka  ======
         Pundamilia nyererei  ======
                 Zebra mbuna  ======
       Burton's mouthbreeder  ======
         Princess of Burundi  ======
B D              Nile tilapia  ======
B D             X. tropicalis  ======
  D            Painted turtle  ======
  D           Green seaturtle  ======
B D        American alligator  ======
  D             Scarlet macaw  ======
B D                Budgerigar  ======
B D                   Opossum  ======
                  Chinchilla  ======
      Lesser Egyptian jerboa  ======
  D               Rock pigeon  ======
  D       Collared flycatcher  NNNNNN
B D       Medium ground finch  ======
B D                    Lizard  ======
  D          Peregrine falcon  ======
  D              Saker falcon  ======
  D                    Parrot  ======
            Cape golden mole  ======
          Chinese tree shrew  ======
         Cape elephant shrew  ======
B D                  Platypus  ======
B D                   Wallaby  ======
B D           Chinese hamster  ======
                Prairie vole  ======
                    Aardvark  ======
B D                  Elephant  ======
B D                    Tenrec  ======
B D                       Cat  ======
B D                   Megabat  ======
B D                  Bushbaby  ======
B D                       Pig  ======
  D  Chinese softshell turtle  ======
B D                   Dolphin  ======
B D                       Rat  ======
B D                     Mouse  ======
B D                     Panda  ======
             Star-nosed mole  ======
              Bactrian camel  ======
B D                    Alpaca  ======
              Pacific walrus  ======
            Black flying-fox  ======
B D          White rhinoceros  ======
B D                     Horse  ======
B D                 Armadillo  ======
                Weddell seal  ======
        David's myotis (bat)  ======
               Big brown bat  ======
  D          Little brown bat  ======
B D                       Cow  ======
                Killer whale  ======

Inserts between block 7 and 8 in window
B D                 Squirrel 7bp
B D           Naked mole-rat 13bp

Alignment block 8 of 941 in window, 56745497 - 56745506, 10 bps 
B D                     Human  ----aataaatcta
B D                     Chimp  ----aataaatcta
B D                   Gorilla  ----aataaatcta
B D                 Orangutan  ----aataaatcta
B D                    Gibbon  ----aataaatcta
B D                    Rhesus  ----gataaatcta
B D              Green monkey  ----gataaatcta
B D                  Marmoset  ----aacaaatcta
B D           Squirrel monkey  ----aataaatcta
B D                  Bushbaby  ----agcaaattaa
B D                  Squirrel  ----agtaaattaa
B D            Naked mole-rat  ----gataaattaa
             Tibetan antelope  ----tataaatctt
B D                     Sheep  ----tataaatctt
                Domestic goat  ----tataaatctt
B D                       Dog  ----tagaaaag--
B D                   Ferret   ----cagaaaag--
B D                   Manatee  acttgacata----
B D                  Hedgehog  ==============
B D                Guinea pig  ==============
B D                      Pika  ==============
B D                    Rabbit  ==============
B D                   Lamprey  ==============
B D                Coelacanth  ==============
B D                     Shrew  ==============
              Golden hamster  ==============
B D                    Baboon  ==============
B D       Crab-eating macaque  NNNNNNNNNNNNNN
            Brush-tailed rat  ==============
B D              Atlantic cod  ==============
                 Spotted gar  ==============
B D               Stickleback  ==============
          Southern platyfish  ==============
      Yellowbelly pufferfish  ==============
B D                      Fugu  ==============
B D                    Turkey  ==============
B D                   Chicken  ==============
  D              Mallard duck  ==============
          Tibetan ground jay  ==============
B D               Zebra finch  ==============
B D           Tasmanian devil  ==============
    Mexican tetra (cavefish)  ==============
B D                 Zebrafish  ==============
B D                    Medaka  ==============
         Pundamilia nyererei  ==============
                 Zebra mbuna  ==============
       Burton's mouthbreeder  ==============
         Princess of Burundi  ==============
B D              Nile tilapia  ==============
B D             X. tropicalis  ==============
  D            Painted turtle  ==============
  D           Green seaturtle  ==============
B D        American alligator  ==============
  D             Scarlet macaw  ==============
B D                Budgerigar  ==============
B D                   Opossum  ==============
                  Chinchilla  ==============
      Lesser Egyptian jerboa  ==============
  D               Rock pigeon  ==============
  D       Collared flycatcher  NNNNNNNNNNNNNN
B D       Medium ground finch  ==============
B D                    Lizard  ==============
  D          Peregrine falcon  ==============
  D              Saker falcon  ==============
  D                    Parrot  ==============
            Cape golden mole  ==============
          Chinese tree shrew  ==============
         Cape elephant shrew  ==============
B D                  Platypus  ==============
B D                   Wallaby  ==============
B D           Chinese hamster  ==============
                Prairie vole  ==============
                    Aardvark  ==============
B D                  Elephant  ==============
B D                    Tenrec  ==============
B D                       Cat  ==============
B D                   Megabat  ==============
B D                       Pig  ==============
  D  Chinese softshell turtle  ==============
B D                   Dolphin  ==============
B D                       Rat  ==============
B D                     Mouse  ==============
B D                     Panda  ==============
             Star-nosed mole  ==============
              Bactrian camel  ==============
B D                    Alpaca  ==============
              Pacific walrus  ==============
            Black flying-fox  ==============
B D          White rhinoceros  ==============
B D                     Horse  ==============
B D                 Armadillo  ==============
                Weddell seal  ==============
        David's myotis (bat)  ==============
               Big brown bat  ==============
  D          Little brown bat  ==============
B D                       Cow  ==============
                Killer whale  ==============

Inserts between block 8 and 9 in window
B D                   Rhesus 307bp
            Tibetan antelope 2bp
B D                    Sheep 2bp
               Domestic goat 2bp

Alignment block 9 of 941 in window, 56745507 - 56745508, 2 bps 
B D                     Human  -tt
B D                     Chimp  -tt
B D                   Gorilla  -tt
B D                 Orangutan  -tt
B D                    Gibbon  -tt
B D              Green monkey  -tt
B D                  Marmoset  -tt
B D           Squirrel monkey  -tt
B D                  Bushbaby  -tt
B D                  Squirrel  -tc
B D            Naked mole-rat  -tt
B D                   Manatee  at-
B D                  Hedgehog  ===
B D                Guinea pig  ===
B D                      Pika  ===
B D                    Rabbit  ===
B D                   Lamprey  ===
B D                Coelacanth  ===
B D                     Shrew  ===
              Golden hamster  ===
B D                    Baboon  ===
B D       Crab-eating macaque  NNN
B D                    Rhesus  ===
            Brush-tailed rat  ===
B D              Atlantic cod  ===
                 Spotted gar  ===
B D               Stickleback  ===
          Southern platyfish  ===
      Yellowbelly pufferfish  ===
B D                      Fugu  ===
B D                    Turkey  ===
B D                   Chicken  ===
  D              Mallard duck  ===
          Tibetan ground jay  ===
B D               Zebra finch  ===
B D           Tasmanian devil  ===
    Mexican tetra (cavefish)  ===
B D                 Zebrafish  ===
B D                    Medaka  ===
         Pundamilia nyererei  ===
                 Zebra mbuna  ===
       Burton's mouthbreeder  ===
         Princess of Burundi  ===
B D              Nile tilapia  ===
B D             X. tropicalis  ===
  D            Painted turtle  ===
  D           Green seaturtle  ===
B D        American alligator  ===
  D             Scarlet macaw  ===
B D                Budgerigar  ===
B D                   Opossum  ===
                  Chinchilla  ===
      Lesser Egyptian jerboa  ===
  D               Rock pigeon  ===
  D       Collared flycatcher  NNN
B D       Medium ground finch  ===
B D                    Lizard  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
  D                    Parrot  ===
            Cape golden mole  ===
          Chinese tree shrew  ===
         Cape elephant shrew  ===
B D                  Platypus  ===
B D                   Wallaby  ===
B D           Chinese hamster  ===
                Prairie vole  ===
                    Aardvark  ===
B D                  Elephant  ===
B D                    Tenrec  ===
B D                       Cat  ===
B D                   Megabat  ===
B D                       Pig  ===
  D  Chinese softshell turtle  ===
B D                   Ferret   ---
B D                   Dolphin  ===
B D                       Rat  ===
B D                     Mouse  ===
B D                     Panda  ===
               Domestic goat  ===
B D                     Sheep  ===
            Tibetan antelope  ===
             Star-nosed mole  ===
              Bactrian camel  ===
B D                    Alpaca  ===
              Pacific walrus  ===
            Black flying-fox  ===
B D          White rhinoceros  ===
B D                     Horse  ===
B D                 Armadillo  ===
                Weddell seal  ===
        David's myotis (bat)  ===
               Big brown bat  ===
  D          Little brown bat  ===
B D                       Dog  ---
B D                       Cow  ===
                Killer whale  ===

Inserts between block 9 and 10 in window
B D             Green monkey 306bp

Alignment block 10 of 941 in window, 56745509 - 56745512, 4 bps 
B D                     Human  ttat
B D                     Chimp  ttat
B D                   Gorilla  ttat
B D                 Orangutan  ttat
B D                    Gibbon  ttat
B D                    Rhesus  ttat
B D                    Baboon  ttat
B D              Green monkey  ttat
B D                  Bushbaby  -ttt
B D                  Squirrel  -ttt
B D            Naked mole-rat  -ttt
             Tibetan antelope  ttaa
B D                     Sheep  ttaa
                Domestic goat  ttaa
B D                   Manatee  tgat
B D                  Hedgehog  ====
B D                Guinea pig  ====
B D                      Pika  ====
B D                    Rabbit  ====
B D                   Lamprey  ====
B D                Coelacanth  ====
B D                     Shrew  ====
              Golden hamster  ====
B D       Crab-eating macaque  NNNN
            Brush-tailed rat  ====
B D              Atlantic cod  ====
                 Spotted gar  ====
B D               Stickleback  ====
          Southern platyfish  ====
      Yellowbelly pufferfish  ====
B D                      Fugu  ====
B D                    Turkey  ====
B D                   Chicken  ====
  D              Mallard duck  ====
          Tibetan ground jay  ====
B D               Zebra finch  ====
B D           Tasmanian devil  ====
    Mexican tetra (cavefish)  ====
B D                 Zebrafish  ====
B D                    Medaka  ====
         Pundamilia nyererei  ====
                 Zebra mbuna  ====
       Burton's mouthbreeder  ====
         Princess of Burundi  ====
B D              Nile tilapia  ====
B D             X. tropicalis  ====
  D            Painted turtle  ====
  D           Green seaturtle  ====
B D        American alligator  ====
  D             Scarlet macaw  ====
B D                Budgerigar  ====
B D                   Opossum  ====
                  Chinchilla  ====
      Lesser Egyptian jerboa  ====
  D               Rock pigeon  ====
  D       Collared flycatcher  NNNN
B D       Medium ground finch  ====
B D                    Lizard  ====
  D          Peregrine falcon  ====
  D              Saker falcon  ====
  D                    Parrot  ====
            Cape golden mole  ====
          Chinese tree shrew  ====
         Cape elephant shrew  ====
B D                  Platypus  ====
B D                   Wallaby  ====
B D           Chinese hamster  ====
                Prairie vole  ====
                    Aardvark  ====
B D                  Elephant  ====
B D                    Tenrec  ====
B D                       Cat  ====
B D                   Megabat  ====
B D                       Pig  ====
  D  Chinese softshell turtle  ====
B D                   Ferret   ----
B D                   Dolphin  ====
B D                       Rat  ====
B D                     Mouse  ====
B D                     Panda  ====
             Star-nosed mole  ====
              Bactrian camel  ====
B D                    Alpaca  ====
              Pacific walrus  ====
            Black flying-fox  ====
B D          White rhinoceros  ====
B D                     Horse  ====
B D                 Armadillo  ====
                Weddell seal  ====
        David's myotis (bat)  ====
               Big brown bat  ====
  D          Little brown bat  ====
B D           Squirrel monkey  ----
B D                  Marmoset  ----
B D                       Dog  ----
B D                       Cow  ====
                Killer whale  ====

Alignment block 11 of 941 in window, 56745513 - 56745515, 3 bps 
B D                     Human  cta
B D                     Chimp  cta
B D                   Gorilla  cta
B D                 Orangutan  cta
B D                    Gibbon  cta
B D                    Rhesus  cta
B D                    Baboon  cta
B D              Green monkey  cta
B D                  Marmoset  tta
B D           Squirrel monkey  tta
B D                  Bushbaby  ctg
B D                  Squirrel  ttt
B D            Naked mole-rat  tta
B D                    Alpaca  cta
             Tibetan antelope  ctt
B D                     Sheep  ctt
                Domestic goat  ctt
B D                       Dog  caa
B D                   Ferret   tc-
                Big brown bat  cta
         David's myotis (bat)  cta
  D          Little brown bat  cta
B D                   Manatee  cta
B D                  Hedgehog  ===
B D                Guinea pig  ===
B D                      Pika  ===
B D                    Rabbit  ===
B D                   Lamprey  ===
B D                Coelacanth  ===
B D                     Shrew  ===
              Golden hamster  ===
B D       Crab-eating macaque  NNN
            Brush-tailed rat  ===
B D              Atlantic cod  ===
                 Spotted gar  ===
B D               Stickleback  ===
          Southern platyfish  ===
      Yellowbelly pufferfish  ===
B D                      Fugu  ===
B D                    Turkey  ===
B D                   Chicken  ===
  D              Mallard duck  ===
          Tibetan ground jay  ===
B D               Zebra finch  ===
B D           Tasmanian devil  ===
    Mexican tetra (cavefish)  ===
B D                 Zebrafish  ===
B D                    Medaka  ===
         Pundamilia nyererei  ===
                 Zebra mbuna  ===
       Burton's mouthbreeder  ===
         Princess of Burundi  ===
B D              Nile tilapia  ===
B D             X. tropicalis  ===
  D            Painted turtle  ===
  D           Green seaturtle  ===
B D        American alligator  ===
  D             Scarlet macaw  ===
B D                Budgerigar  ===
B D                   Opossum  ===
                  Chinchilla  ===
      Lesser Egyptian jerboa  ===
  D               Rock pigeon  ===
  D       Collared flycatcher  NNN
B D       Medium ground finch  ===
B D                    Lizard  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
  D                    Parrot  ===
            Cape golden mole  ===
          Chinese tree shrew  ===
         Cape elephant shrew  ===
B D                  Platypus  ===
B D                   Wallaby  ===
B D           Chinese hamster  ===
                Prairie vole  ===
                    Aardvark  ===
B D                  Elephant  ===
B D                    Tenrec  ===
B D                       Cat  ===
B D                   Megabat  ===
B D                       Pig  ===
  D  Chinese softshell turtle  ===
B D                   Dolphin  ===
B D                       Rat  ===
B D                     Mouse  ===
B D                     Panda  ===
             Star-nosed mole  ===
              Bactrian camel  ===
              Pacific walrus  ===
            Black flying-fox  ===
B D          White rhinoceros  ===
B D                     Horse  ===
B D                 Armadillo  ===
                Weddell seal  ===
B D                       Cow  ===
                Killer whale  ===

Inserts between block 11 and 12 in window
B D                  Manatee 11bp

Alignment block 12 of 941 in window, 56745516 - 56745517, 2 bps 
B D                     Human  tt-
B D                     Chimp  tt-
B D                   Gorilla  tt-
B D                 Orangutan  tt-
B D                    Gibbon  tt-
B D                    Rhesus  tt-
B D                    Baboon  tt-
B D              Green monkey  tt-
B D                  Marmoset  tc-
B D           Squirrel monkey  tc-
B D                  Bushbaby  tt-
B D                  Squirrel  tt-
B D            Naked mole-rat  t--
B D                       Pig  tt-
B D                    Alpaca  -g-
             Tibetan antelope  -t-
B D                     Sheep  -t-
                Domestic goat  -t-
B D                       Dog  tt-
                Big brown bat  tt-
         David's myotis (bat)  tt-
  D          Little brown bat  tt-
B D                   Manatee  -ta
B D                  Hedgehog  ===
B D                Guinea pig  ===
B D                      Pika  ===
B D                    Rabbit  ===
B D                   Lamprey  ===
B D                Coelacanth  ===
B D                     Shrew  ===
              Golden hamster  ===
B D       Crab-eating macaque  NNN
            Brush-tailed rat  ===
B D              Atlantic cod  ===
                 Spotted gar  ===
B D               Stickleback  ===
          Southern platyfish  ===
      Yellowbelly pufferfish  ===
B D                      Fugu  ===
B D                    Turkey  ===
B D                   Chicken  ===
  D              Mallard duck  ===
          Tibetan ground jay  ===
B D               Zebra finch  ===
B D           Tasmanian devil  ===
    Mexican tetra (cavefish)  ===
B D                 Zebrafish  ===
B D                    Medaka  ===
         Pundamilia nyererei  ===
                 Zebra mbuna  ===
       Burton's mouthbreeder  ===
         Princess of Burundi  ===
B D              Nile tilapia  ===
B D             X. tropicalis  ===
  D            Painted turtle  ===
  D           Green seaturtle  ===
B D        American alligator  ===
  D             Scarlet macaw  ===
B D                Budgerigar  ===
B D                   Opossum  ===
                  Chinchilla  ===
      Lesser Egyptian jerboa  ===
  D               Rock pigeon  ===
  D       Collared flycatcher  NNN
B D       Medium ground finch  ===
B D                    Lizard  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
  D                    Parrot  ===
            Cape golden mole  ===
          Chinese tree shrew  ===
         Cape elephant shrew  ===
B D                  Platypus  ===
B D                   Wallaby  ===
B D           Chinese hamster  ===
                Prairie vole  ===
                    Aardvark  ===
B D                  Elephant  ===
B D                    Tenrec  ===
B D                       Cat  ===
B D                   Megabat  ===
  D  Chinese softshell turtle  ===
B D                   Ferret   ---
B D                   Dolphin  ===
B D                       Rat  ===
B D                     Mouse  ===
B D                     Panda  ===
             Star-nosed mole  ===
              Bactrian camel  ===
              Pacific walrus  ===
            Black flying-fox  ===
B D          White rhinoceros  ===
B D                     Horse  ===
B D                 Armadillo  ===
                Weddell seal  ===
B D                       Cow  ===
                Killer whale  ===

Inserts between block 12 and 13 in window
B D                   Alpaca 1bp
               Big brown bat 1bp
        David's myotis (bat) 1bp
  D         Little brown bat 1bp

Alignment block 13 of 941 in window, 56745518 - 56745518, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                  Bushbaby  a
B D                    Rabbit  a
B D                       Pig  a
               Bactrian camel  a
B D                   Dolphin  a
                 Killer whale  a
             Tibetan antelope  a
B D                     Sheep  a
                Domestic goat  a
B D                     Horse  a
B D          White rhinoceros  a
B D                   Ferret   a
B D                     Panda  a
               Pacific walrus  a
                 Weddell seal  a
             Black flying-fox  a
B D                   Megabat  a
                Big brown bat  a
         David's myotis (bat)  a
  D          Little brown bat  a
B D                  Elephant  a
B D                   Manatee  a
             Cape golden mole  a
B D                    Tenrec  a
B D                 Armadillo  a
B D                  Hedgehog  =
B D                Guinea pig  =
B D                      Pika  =
B D                   Lamprey  =
B D                Coelacanth  =
B D                     Shrew  =
              Golden hamster  =
B D       Crab-eating macaque  N
            Brush-tailed rat  =
B D              Atlantic cod  =
                 Spotted gar  =
B D               Stickleback  =
          Southern platyfish  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  =
B D           Tasmanian devil  =
    Mexican tetra (cavefish)  =
B D                 Zebrafish  =
B D                    Medaka  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D              Nile tilapia  =
B D             X. tropicalis  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  =
  D             Scarlet macaw  =
B D                Budgerigar  =
B D                   Opossum  =
                  Chinchilla  =
B D            Naked mole-rat  -
      Lesser Egyptian jerboa  =
  D               Rock pigeon  =
  D       Collared flycatcher  N
B D       Medium ground finch  =
B D                    Lizard  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
          Chinese tree shrew  =
         Cape elephant shrew  =
B D                  Platypus  =
B D                   Wallaby  =
B D           Chinese hamster  =
                Prairie vole  =
                    Aardvark  =
B D                       Cat  =
  D  Chinese softshell turtle  =
B D                       Rat  =
B D                     Mouse  =
             Star-nosed mole  =
B D                    Alpaca  =
B D                  Squirrel  -
B D                       Dog  -
B D                       Cow  =

Alignment block 14 of 941 in window, 56745519 - 56745520, 2 bps 
B D                     Human  tt
B D                     Chimp  tt
B D                   Gorilla  tt
B D                 Orangutan  tt
B D                    Gibbon  tt
B D                    Rhesus  tt
B D                    Baboon  tt
B D              Green monkey  tt
B D                  Marmoset  tt
B D           Squirrel monkey  tt
B D                  Bushbaby  gt
B D                    Rabbit  tt
B D                       Pig  tc
               Bactrian camel  tc
B D                   Dolphin  tc
                 Killer whale  tc
             Tibetan antelope  ct
B D                     Sheep  ct
                Domestic goat  ct
B D                     Horse  tc
B D          White rhinoceros  tc
B D                       Dog  tt
B D                   Ferret   tt
B D                     Panda  tt
               Pacific walrus  tt
                 Weddell seal  tt
             Black flying-fox  tc
B D                   Megabat  tc
                Big brown bat  tc
         David's myotis (bat)  tc
  D          Little brown bat  tc
B D                  Elephant  tc
B D                   Manatee  tc
             Cape golden mole  tc
B D                    Tenrec  tc
                     Aardvark  tc
B D                 Armadillo  tt
B D                  Hedgehog  ==
B D                Guinea pig  ==
B D                      Pika  ==
B D                   Lamprey  ==
B D                Coelacanth  ==
B D                     Shrew  ==
              Golden hamster  ==
B D       Crab-eating macaque  NN
            Brush-tailed rat  ==
B D              Atlantic cod  ==
                 Spotted gar  ==
B D               Stickleback  ==
          Southern platyfish  ==
      Yellowbelly pufferfish  ==
B D                      Fugu  ==
B D                    Turkey  ==
B D                   Chicken  ==
  D              Mallard duck  ==
          Tibetan ground jay  ==
B D               Zebra finch  ==
B D           Tasmanian devil  ==
    Mexican tetra (cavefish)  ==
B D                 Zebrafish  ==
B D                    Medaka  ==
         Pundamilia nyererei  ==
                 Zebra mbuna  ==
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
B D              Nile tilapia  ==
B D             X. tropicalis  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D        American alligator  ==
  D             Scarlet macaw  ==
B D                Budgerigar  ==
B D                   Opossum  ==
                  Chinchilla  ==
B D            Naked mole-rat  --
      Lesser Egyptian jerboa  ==
  D               Rock pigeon  ==
  D       Collared flycatcher  NN
B D       Medium ground finch  ==
B D                    Lizard  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D                    Parrot  ==
          Chinese tree shrew  ==
         Cape elephant shrew  ==
B D                  Platypus  ==
B D                   Wallaby  ==
B D           Chinese hamster  ==
                Prairie vole  ==
B D                       Cat  ==
  D  Chinese softshell turtle  ==
B D                       Rat  ==
B D                     Mouse  ==
             Star-nosed mole  ==
B D                    Alpaca  ==
B D                  Squirrel  --
B D                       Cow  ==

Inserts between block 14 and 15 in window
            Tibetan antelope 32bp
B D                    Sheep 32bp
               Domestic goat 32bp

Alignment block 15 of 941 in window, 56745521 - 56745551, 31 bps 
B D                     Human  ttacatatgcca-c-aaagcaagatatt-tatag
B D                     Chimp  ttacatatgcca-c-aaaggaagatatt-tatag
B D                   Gorilla  ttacatatgcca-c-aaaggaagatatt-tatag
B D                 Orangutan  tgacatatgcca-c-aaaggaagatatt-tatag
B D                    Gibbon  ttacatatgcca-c-aaaggaatatatt-tatag
B D                    Rhesus  ttatatatgccacc-aaaggaagatttt-tatag
B D                    Baboon  ttatatatgccacc-aaaggaagatttt-tatag
B D              Green monkey  ttatatatgccacc-aaa-gaagatttt-tatag
B D                  Marmoset  ttacatatgtca-c-aaaggaaga--tt-tatag
B D           Squirrel monkey  ttacatatgtca-c-aaaggaaga--tt-tatag
B D                  Bushbaby  -----------a-c-aaaggaggatact-tacag
B D                  Squirrel  --ttttttgtca-c-aaaggagaatact-tacag
B D            Naked mole-rat  -------------c-aaaggaaga-----tacag
B D                    Rabbit  ttccttttgcca-c-aaaagaggacact-tacag
B D                       Pig  ttccttttccca-c-aaaggaggatact-cacag
B D                    Alpaca  ----atttgaca-c-aacattgtaaaat-gatta
               Bactrian camel  ttccttttgcca-c-aaagaaggatact-gaaaa
B D                   Dolphin  ttccttatgcca-c-aaaggaggatgcttaacag
                 Killer whale  ttccttatgcca-c-aaaggaggatgcttaacag
             Tibetan antelope  ttccttttgcca-c-a-------------tacag
B D                       Cow  ttccttttgcta-c-aaaggaggatac-ttacag
B D                     Sheep  ttccttttgcca-c-a-------------tacag
                Domestic goat  ttccttttgcca-c-a-------------tacag
B D                     Horse  ttccttttgcca-c-aaagggggatgct-ttca-
B D          White rhinoceros  ttccttttgcta-caaaaggaggatact-tacag
B D                       Dog  ttccttttgtta-c-aaaggaggatatt-tacag
B D                   Ferret   ttcctcttgcta-c--aaggaggatact-tacag
B D                     Panda  ttccttttgcta-c-aaaggagcatact-tacag
               Pacific walrus  ttccttttgcta-c-aaaggaggatact-tacag
                 Weddell seal  ttccttttgcta-c-aaaggaggatact-tatag
             Black flying-fox  ttccttttgcca-c-aaaggaagatact-taaaa
B D                   Megabat  ttccttttgcca-c-aaaggaagatact-tacaa
                Big brown bat  ttccttttgcaa-c-aaaggaggatact-t-aaa
         David's myotis (bat)  tgccttttgcaa-c-aaaggagggtatt-taaaa
  D          Little brown bat  ttccttttgcaa-c-aaaggaggatatt-taaaa
              Star-nosed mole  ttactttggcga-c-aaaggtgagcact-tacag
B D                  Elephant  tttcttttgcca-c-aaaggagtatact-tataa
          Cape elephant shrew  tttcttttgtca-a-agaggaggatact-tac--
B D                   Manatee  ttccttttgcca-c-aaaggagtatact-taa--
             Cape golden mole  ttccttttgcca-c-aaagg---attct-t----
B D                    Tenrec  ttccttttgcca-c-aaaca---atgcc-tatca
                     Aardvark  ttccttttgcca-t-aaagaaggatact-tacaa
B D                 Armadillo  atccttttgcca-c-agagg---acact-tacta
B D                  Hedgehog  ==================================
B D                Guinea pig  ==================================
B D                      Pika  ==================================
B D                   Lamprey  ==================================
B D                Coelacanth  ==================================
B D                     Shrew  ==================================
              Golden hamster  ==================================
B D       Crab-eating macaque  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            Brush-tailed rat  ==================================
B D              Atlantic cod  ==================================
                 Spotted gar  ==================================
B D               Stickleback  ==================================
          Southern platyfish  ==================================
      Yellowbelly pufferfish  ==================================
B D                      Fugu  ==================================
B D                    Turkey  ==================================
B D                   Chicken  ==================================
  D              Mallard duck  ==================================
          Tibetan ground jay  ==================================
B D               Zebra finch  ==================================
B D           Tasmanian devil  ==================================
    Mexican tetra (cavefish)  ==================================
B D                 Zebrafish  ==================================
B D                    Medaka  ==================================
         Pundamilia nyererei  ==================================
                 Zebra mbuna  ==================================
       Burton's mouthbreeder  ==================================
         Princess of Burundi  ==================================
B D              Nile tilapia  ==================================
B D             X. tropicalis  ==================================
  D            Painted turtle  ==================================
  D           Green seaturtle  ==================================
B D        American alligator  ==================================
  D             Scarlet macaw  ==================================
B D                Budgerigar  ==================================
B D                   Opossum  ==================================
                  Chinchilla  ==================================
      Lesser Egyptian jerboa  ==================================
  D               Rock pigeon  ==================================
  D       Collared flycatcher  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D       Medium ground finch  ==================================
B D                    Lizard  ==================================
  D          Peregrine falcon  ==================================
  D              Saker falcon  ==================================
  D                    Parrot  ==================================
          Chinese tree shrew  ==================================
B D                  Platypus  ==================================
B D                   Wallaby  ==================================
B D           Chinese hamster  ==================================
                Prairie vole  ==================================
B D                       Cat  ==================================
  D  Chinese softshell turtle  ==================================
B D                       Rat  ==================================
B D                     Mouse  ==================================

Alignment block 16 of 941 in window, 56745552 - 56745560, 9 bps 
B D                     Human  caaaat-aaa
B D                     Chimp  caaaat-aaa
B D                   Gorilla  caaaat-aaa
B D                 Orangutan  caaaat-aaa
B D                    Gibbon  caaaat-aaa
B D                    Rhesus  caaaat-aaa
B D                    Baboon  caaaat-aaa
B D              Green monkey  caaaat-aaa
B D                  Marmoset  -----t-gaa
B D           Squirrel monkey  caaaat-aaa
B D                  Bushbaby  caaaat-a--
B D                  Squirrel  caaaat-ag-
B D            Naked mole-rat  caaat-----
B D                    Rabbit  caagtt-a--
B D                       Pig  caaaat-ata
B D                    Alpaca  taaatcaata
               Bactrian camel  caaaat-atg
B D                   Dolphin  caaaat-atg
                 Killer whale  caaaat-atg
             Tibetan antelope  caaaat-atg
B D                       Cow  caaaat-atg
B D                     Sheep  caaaat-atg
                Domestic goat  caaaat-atg
B D                     Horse  -aaaat-atg
B D          White rhinoceros  caaaat-atg
B D                       Dog  taaaat-atg
B D                   Ferret   caaaat-atg
B D                     Panda  caaaat-atg
               Pacific walrus  taaaat-atg
                 Weddell seal  caaaat-atg
             Black flying-fox  caaaat-atg
B D                   Megabat  caaaat-atg
                Big brown bat  caaaat-atg
         David's myotis (bat)  caaaat-atg
  D          Little brown bat  caaaat-atg
B D                     Shrew  caaaaa-gaa
              Star-nosed mole  cagaat-ata
B D                  Elephant  caaaat----
B D                   Manatee  ---aac----
             Cape golden mole  -aacat----
B D                    Tenrec  caaaat----
                     Aardvark  caaaat----
B D                 Armadillo  taaaat----
B D                  Hedgehog  ==========
B D                Guinea pig  ==========
B D                      Pika  ==========
B D                   Lamprey  ==========
B D                Coelacanth  ==========
              Golden hamster  ==========
B D       Crab-eating macaque  NNNNNNNNNN
            Brush-tailed rat  ==========
B D              Atlantic cod  ==========
                 Spotted gar  ==========
B D               Stickleback  ==========
          Southern platyfish  ==========
      Yellowbelly pufferfish  ==========
B D                      Fugu  ==========
B D                    Turkey  ==========
B D                   Chicken  ==========
  D              Mallard duck  ==========
          Tibetan ground jay  ==========
B D               Zebra finch  ==========
B D           Tasmanian devil  ==========
    Mexican tetra (cavefish)  ==========
B D                 Zebrafish  ==========
B D                    Medaka  ==========
         Pundamilia nyererei  ==========
                 Zebra mbuna  ==========
       Burton's mouthbreeder  ==========
         Princess of Burundi  ==========
B D              Nile tilapia  ==========
B D             X. tropicalis  ==========
  D            Painted turtle  ==========
  D           Green seaturtle  ==========
B D        American alligator  ==========
  D             Scarlet macaw  ==========
B D                Budgerigar  ==========
B D                   Opossum  ==========
                  Chinchilla  ==========
      Lesser Egyptian jerboa  ==========
  D               Rock pigeon  ==========
  D       Collared flycatcher  NNNNNNNNNN
B D       Medium ground finch  ==========
B D                    Lizard  ==========
  D          Peregrine falcon  ==========
  D              Saker falcon  ==========
  D                    Parrot  ==========
          Chinese tree shrew  ==========
         Cape elephant shrew  ----------
B D                  Platypus  ==========
B D                   Wallaby  ==========
B D           Chinese hamster  ==========
                Prairie vole  ==========
B D                       Cat  ==========
  D  Chinese softshell turtle  ==========
B D                       Rat  ==========
B D                     Mouse  ==========

Inserts between block 16 and 17 in window
        David's myotis (bat) 1bp
B D                    Shrew 10bp
             Star-nosed mole 10bp

Alignment block 17 of 941 in window, 56745561 - 56745561, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D           Chinese hamster  a
               Golden hamster  a
B D            Naked mole-rat  a
                   Chinchilla  a
B D                  Elephant  a
B D                   Manatee  a
             Cape golden mole  a
B D                    Tenrec  a
                     Aardvark  a
B D                 Armadillo  a
B D                  Hedgehog  =
B D                Guinea pig  =
B D                      Pika  =
B D                    Rabbit  -
B D                   Lamprey  =
B D                Coelacanth  =
B D                     Shrew  =
B D       Crab-eating macaque  N
            Brush-tailed rat  =
B D              Atlantic cod  =
                 Spotted gar  =
B D               Stickleback  =
          Southern platyfish  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  =
B D           Tasmanian devil  =
    Mexican tetra (cavefish)  =
B D                 Zebrafish  =
B D                    Medaka  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D              Nile tilapia  =
B D             X. tropicalis  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  =
  D             Scarlet macaw  =
B D                Budgerigar  =
B D                   Opossum  =
      Lesser Egyptian jerboa  =
  D               Rock pigeon  =
  D       Collared flycatcher  N
B D       Medium ground finch  =
B D                    Lizard  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
          Chinese tree shrew  =
         Cape elephant shrew  -
B D                  Platypus  =
B D                   Wallaby  =
                Prairie vole  =
B D                       Cat  =
B D                   Megabat  -
B D                  Bushbaby  -
B D                       Pig  -
  D  Chinese softshell turtle  =
B D                   Ferret   -
B D                   Dolphin  -
B D                       Rat  =
B D                     Mouse  =
B D                     Panda  -
               Domestic goat  -
B D                     Sheep  -
            Tibetan antelope  -
             Star-nosed mole  =
              Bactrian camel  -
B D                    Alpaca  -
              Pacific walrus  -
            Black flying-fox  -
B D          White rhinoceros  -
B D                     Horse  -
B D                  Squirrel  -
                Weddell seal  -
        David's myotis (bat)  =
               Big brown bat  -
  D          Little brown bat  -
B D                       Dog  -
B D                       Cow  -
                Killer whale  -

Alignment block 18 of 941 in window, 56745562 - 56745563, 2 bps 
B D                     Human  tg
B D                     Chimp  tg
B D                   Gorilla  tg
B D                 Orangutan  tg
B D                    Gibbon  tg
B D                    Rhesus  tg
B D                    Baboon  tg
B D              Green monkey  tg
B D                  Marmoset  tg
B D           Squirrel monkey  tg
B D                  Squirrel  -g
                 Prairie vole  tg
B D           Chinese hamster  ta
               Golden hamster  tg
B D            Naked mole-rat  tg
                   Chinchilla  ca
B D                    Rabbit  cg
B D                  Elephant  tg
B D                   Manatee  tg
             Cape golden mole  ta
B D                    Tenrec  tc
                     Aardvark  tg
B D                 Armadillo  tg
B D                  Hedgehog  ==
B D                Guinea pig  ==
B D                      Pika  ==
B D                   Lamprey  ==
B D                Coelacanth  ==
B D                     Shrew  ==
B D       Crab-eating macaque  NN
            Brush-tailed rat  ==
B D              Atlantic cod  ==
                 Spotted gar  ==
B D               Stickleback  ==
          Southern platyfish  ==
      Yellowbelly pufferfish  ==
B D                      Fugu  ==
B D                    Turkey  ==
B D                   Chicken  ==
  D              Mallard duck  ==
          Tibetan ground jay  ==
B D               Zebra finch  ==
B D           Tasmanian devil  ==
    Mexican tetra (cavefish)  ==
B D                 Zebrafish  ==
B D                    Medaka  ==
         Pundamilia nyererei  ==
                 Zebra mbuna  ==
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
B D              Nile tilapia  ==
B D             X. tropicalis  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D        American alligator  ==
  D             Scarlet macaw  ==
B D                Budgerigar  ==
B D                   Opossum  ==
      Lesser Egyptian jerboa  ==
  D               Rock pigeon  ==
  D       Collared flycatcher  NN
B D       Medium ground finch  ==
B D                    Lizard  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D                    Parrot  ==
          Chinese tree shrew  ==
         Cape elephant shrew  --
B D                  Platypus  ==
B D                   Wallaby  ==
B D                       Cat  ==
B D                   Megabat  --
B D                  Bushbaby  --
B D                       Pig  --
  D  Chinese softshell turtle  ==
B D                   Ferret   --
B D                   Dolphin  --
B D                       Rat  ==
B D                     Mouse  ==
B D                     Panda  --
               Domestic goat  --
B D                     Sheep  --
            Tibetan antelope  --
             Star-nosed mole  ==
              Bactrian camel  --
B D                    Alpaca  --
              Pacific walrus  --
            Black flying-fox  --
B D          White rhinoceros  --
B D                     Horse  --
                Weddell seal  --
        David's myotis (bat)  ==
               Big brown bat  --
  D          Little brown bat  --
B D                       Dog  --
B D                       Cow  --
                Killer whale  --

Alignment block 19 of 941 in window, 56745564 - 56745568, 5 bps 
B D                     Human  aaata
B D                     Chimp  aaata
B D                   Gorilla  aaata
B D                 Orangutan  aaata
B D                    Gibbon  aaata
B D                    Rhesus  aaata
B D                    Baboon  aaata
B D              Green monkey  aaata
B D                  Marmoset  aaata
B D           Squirrel monkey  aaata
B D                  Bushbaby  aaata
B D                  Squirrel  aaata
                 Prairie vole  tagta
B D           Chinese hamster  tagta
               Golden hamster  tagta
B D                       Rat  aagta
B D            Naked mole-rat  aaata
                   Chinchilla  aaata
B D                    Rabbit  aaata
B D                    Alpaca  aaaaa
               Bactrian camel  aaata
B D                   Dolphin  aagca
                 Killer whale  aagca
             Tibetan antelope  agata
B D                       Cow  agata
B D                     Sheep  agata
                Domestic goat  agata
B D                     Horse  aacta
B D          White rhinoceros  aaata
B D                       Cat  aaaga
B D                       Dog  aaaga
B D                   Ferret   aaaga
B D                     Panda  aaaga
               Pacific walrus  aaaga
                 Weddell seal  aaaga
             Black flying-fox  aaata
B D                   Megabat  aaata
                Big brown bat  aaata
  D          Little brown bat  aaata
B D                  Elephant  aaata
          Cape elephant shrew  -aata
B D                   Manatee  aaata
             Cape golden mole  aaatg
B D                    Tenrec  agcta
                     Aardvark  aaata
B D                 Armadillo  aaata
B D                  Hedgehog  =====
B D                Guinea pig  =====
B D                      Pika  =====
B D                   Lamprey  =====
B D                Coelacanth  =====
B D                     Shrew  =====
B D       Crab-eating macaque  NNNNN
            Brush-tailed rat  =====
B D              Atlantic cod  =====
                 Spotted gar  =====
B D               Stickleback  =====
          Southern platyfish  =====
      Yellowbelly pufferfish  =====
B D                      Fugu  =====
B D                    Turkey  =====
B D                   Chicken  =====
  D              Mallard duck  =====
          Tibetan ground jay  =====
B D               Zebra finch  =====
B D           Tasmanian devil  =====
    Mexican tetra (cavefish)  =====
B D                 Zebrafish  =====
B D                    Medaka  =====
         Pundamilia nyererei  =====
                 Zebra mbuna  =====
       Burton's mouthbreeder  =====
         Princess of Burundi  =====
B D              Nile tilapia  =====
B D             X. tropicalis  =====
  D            Painted turtle  =====
  D           Green seaturtle  =====
B D        American alligator  =====
  D             Scarlet macaw  =====
B D                Budgerigar  =====
B D                   Opossum  =====
      Lesser Egyptian jerboa  =====
  D               Rock pigeon  =====
  D       Collared flycatcher  NNNNN
B D       Medium ground finch  =====
B D                    Lizard  =====
  D          Peregrine falcon  =====
  D              Saker falcon  =====
  D                    Parrot  =====
          Chinese tree shrew  =====
B D                  Platypus  =====
B D                   Wallaby  =====
B D                       Pig  -----
  D  Chinese softshell turtle  =====
B D                     Mouse  =====
             Star-nosed mole  =====
        David's myotis (bat)  =====

Inserts between block 19 and 20 in window
B D                 Squirrel 1bp
                Prairie vole 2bp
B D          Chinese hamster 2bp
              Golden hamster 2bp
B D                      Rat 2bp
                Weddell seal 1bp
            Black flying-fox 1bp
B D                  Megabat 1bp
               Big brown bat 1bp
  D         Little brown bat 1bp

Alignment block 20 of 941 in window, 56745569 - 56745572, 4 bps 
B D                     Human  tctt
B D                     Chimp  tctt
B D                   Gorilla  tctt
B D                 Orangutan  tctt
B D                    Gibbon  tctt
B D                    Rhesus  tctt
B D                    Baboon  tctt
B D              Green monkey  tctt
B D                  Marmoset  tctt
B D           Squirrel monkey  tctt
B D                  Bushbaby  tctt
B D                  Squirrel  tgta
                 Prairie vole  tttc
B D           Chinese hamster  tttc
               Golden hamster  tttc
B D                     Mouse  -ttt
B D                       Rat  -ttt
B D            Naked mole-rat  tctt
                   Chinchilla  tctt
B D                    Rabbit  -ctt
B D                       Pig  --tt
B D                    Alpaca  tgtt
               Bactrian camel  tctt
B D                   Dolphin  tctt
                 Killer whale  tctt
             Tibetan antelope  tctt
B D                       Cow  tctt
B D                     Sheep  tctt
                Domestic goat  tctt
B D                     Horse  tctt
B D          White rhinoceros  tgtt
B D                       Cat  tctt
B D                       Dog  tctt
B D                   Ferret   tctt
B D                     Panda  cctt
               Pacific walrus  tctt
                 Weddell seal  tttt
             Black flying-fox  cttt
B D                   Megabat  cttt
                Big brown bat  cttt
  D          Little brown bat  cttt
B D                  Elephant  tcta
          Cape elephant shrew  tcca
B D                   Manatee  ccta
             Cape golden mole  tcta
B D                    Tenrec  ttta
                     Aardvark  tcta
B D                 Armadillo  ctaa
B D                  Hedgehog  ====
B D                Guinea pig  ====
B D                      Pika  ====
B D                   Lamprey  ====
B D                Coelacanth  ====
B D                     Shrew  ====
B D       Crab-eating macaque  NNNN
            Brush-tailed rat  ====
B D              Atlantic cod  ====
                 Spotted gar  ====
B D               Stickleback  ====
          Southern platyfish  ====
      Yellowbelly pufferfish  ====
B D                      Fugu  ====
B D                    Turkey  ====
B D                   Chicken  ====
  D              Mallard duck  ====
          Tibetan ground jay  ====
B D               Zebra finch  ====
B D           Tasmanian devil  ====
    Mexican tetra (cavefish)  ====
B D                 Zebrafish  ====
B D                    Medaka  ====
         Pundamilia nyererei  ====
                 Zebra mbuna  ====
       Burton's mouthbreeder  ====
         Princess of Burundi  ====
B D              Nile tilapia  ====
B D             X. tropicalis  ====
  D            Painted turtle  ====
  D           Green seaturtle  ====
B D        American alligator  ====
  D             Scarlet macaw  ====
B D                Budgerigar  ====
B D                   Opossum  ====
      Lesser Egyptian jerboa  ====
  D               Rock pigeon  ====
  D       Collared flycatcher  NNNN
B D       Medium ground finch  ====
B D                    Lizard  ====
  D          Peregrine falcon  ====
  D              Saker falcon  ====
  D                    Parrot  ====
          Chinese tree shrew  ====
B D                  Platypus  ====
B D                   Wallaby  ====
  D  Chinese softshell turtle  ====
             Star-nosed mole  ====
        David's myotis (bat)  ====

Inserts between block 20 and 21 in window
B D          Squirrel monkey 827bp
B D                      Pig 2bp
B D                   Alpaca 3bp
              Bactrian camel 3bp
B D                  Dolphin 2bp
                Killer whale 2bp
            Tibetan antelope 2bp
B D                      Cow 3bp
B D                    Sheep 1bp
               Domestic goat 2bp
B D                    Horse 2bp
B D         White rhinoceros 2bp
B D                      Cat 2bp
B D                      Dog 2bp
B D                  Ferret  2bp
B D                    Panda 2bp
              Pacific walrus 2bp
                Weddell seal 2bp
            Black flying-fox 2bp
B D                  Megabat 2bp
               Big brown bat 2bp
  D         Little brown bat 2bp

Alignment block 21 of 941 in window, 56745573 - 56745579, 7 bps 
B D                     Human  aaa--aca--t
B D                     Chimp  aaa--aca--t
B D                   Gorilla  aaa--aca--t
B D                 Orangutan  aaa--aca--t
B D                    Gibbon  aaa--aca--t
B D                    Rhesus  aat--aca--t
B D                    Baboon  aaa--aca--t
B D              Green monkey  aaa--aca--t
B D                  Marmoset  aaa--aca--t
B D           Squirrel monkey  aaa--aca--t
B D                  Bushbaby  aaa--ata--c
B D                  Squirrel  -aa--aag---
                 Prairie vole  -aa--aaa---
B D           Chinese hamster  -aa--aga---
               Golden hamster  -aa--aaa---
B D                     Mouse  -ta--aaa---
B D                       Rat  -ta--aaa---
B D            Naked mole-rat  -aa--acaat-
                   Chinchilla  -aa--acaat-
B D                    Rabbit  -aa--at----
B D                       Pig  aaa--at----
B D                    Alpaca  aaa--aa----
               Bactrian camel  aaa--at----
B D                   Dolphin  aaa--at----
                 Killer whale  aaa--at----
             Tibetan antelope  aaa--at----
B D                       Cow  aaa--at----
B D                     Sheep  aaa--at----
                Domestic goat  aaa--at----
B D                     Horse  aaa--at----
B D          White rhinoceros  aaa--at----
B D                       Cat  aaa--at----
B D                       Dog  aaa--at----
B D                   Ferret   aaa--at----
B D                     Panda  aaa--at----
               Pacific walrus  aaa--at----
                 Weddell seal  aaa--at----
             Black flying-fox  aaa--at----
B D                   Megabat  aaa--at----
                Big brown bat  aaa--ac----
         David's myotis (bat)  aaa--at----
  D          Little brown bat  aaa--at----
B D                     Shrew  aaa--aa----
              Star-nosed mole  caa--at----
B D                  Elephant  aaa--at----
          Cape elephant shrew  aaaacat----
B D                   Manatee  aaaatat----
             Cape golden mole  aaaacac----
B D                    Tenrec  aaagcat----
                     Aardvark  aaaacat----
B D                 Armadillo  aca--at----
B D                  Hedgehog  ===========
B D                Guinea pig  ===========
B D                      Pika  ===========
B D                   Lamprey  ===========
B D                Coelacanth  ===========
B D       Crab-eating macaque  NNNNNNNNNNN
            Brush-tailed rat  ===========
B D              Atlantic cod  ===========
                 Spotted gar  ===========
B D               Stickleback  ===========
          Southern platyfish  ===========
      Yellowbelly pufferfish  ===========
B D                      Fugu  ===========
B D                    Turkey  ===========
B D                   Chicken  ===========
  D              Mallard duck  ===========
          Tibetan ground jay  ===========
B D               Zebra finch  ===========
B D           Tasmanian devil  ===========
    Mexican tetra (cavefish)  ===========
B D                 Zebrafish  ===========
B D                    Medaka  ===========
         Pundamilia nyererei  ===========
                 Zebra mbuna  ===========
       Burton's mouthbreeder  ===========
         Princess of Burundi  ===========
B D              Nile tilapia  ===========
B D             X. tropicalis  ===========
  D            Painted turtle  ===========
  D           Green seaturtle  ===========
B D        American alligator  ===========
  D             Scarlet macaw  ===========
B D                Budgerigar  ===========
B D                   Opossum  ===========
      Lesser Egyptian jerboa  ===========
  D               Rock pigeon  ===========
  D       Collared flycatcher  NNNNNNNNNNN
B D       Medium ground finch  ===========
B D                    Lizard  ===========
  D          Peregrine falcon  ===========
  D              Saker falcon  ===========
  D                    Parrot  ===========
          Chinese tree shrew  ===========
B D                  Platypus  ===========
B D                   Wallaby  ===========
  D  Chinese softshell turtle  ===========

Alignment block 22 of 941 in window, 56745580 - 56745582, 3 bps 
B D                     Human  gta
B D                     Chimp  gta
B D                   Gorilla  gta
B D                 Orangutan  gta
B D                    Gibbon  gta
B D                    Rhesus  gta
B D                    Baboon  gta
B D              Green monkey  gta
B D                  Marmoset  gta
B D           Squirrel monkey  gta
B D                  Bushbaby  gta
B D                  Squirrel  gta
                 Prairie vole  gta
B D           Chinese hamster  gta
               Golden hamster  gta
B D                     Mouse  gta
B D                       Rat  gta
B D            Naked mole-rat  gta
B D                Guinea pig  gtt
                   Chinchilla  gta
B D                    Rabbit  gca
B D                       Pig  gta
B D                    Alpaca  gta
               Bactrian camel  gta
B D                   Dolphin  gta
                 Killer whale  gta
             Tibetan antelope  gta
B D                       Cow  gta
B D                     Sheep  gta
                Domestic goat  ata
B D                     Horse  gta
B D          White rhinoceros  tta
B D                       Cat  gta
B D                       Dog  gta
B D                   Ferret   gta
B D                     Panda  gta
               Pacific walrus  gta
                 Weddell seal  gta
             Black flying-fox  gta
B D                   Megabat  gta
                Big brown bat  ata
         David's myotis (bat)  aga
  D          Little brown bat  ata
B D                     Shrew  gga
              Star-nosed mole  gta
B D                  Elephant  gta
          Cape elephant shrew  tta
B D                   Manatee  gta
             Cape golden mole  ata
B D                    Tenrec  gta
                     Aardvark  gta
B D                 Armadillo  gta
B D                  Hedgehog  ===
B D                      Pika  ===
B D                   Lamprey  ===
B D                Coelacanth  ===
B D       Crab-eating macaque  NNN
            Brush-tailed rat  ===
B D              Atlantic cod  ===
                 Spotted gar  ===
B D               Stickleback  ===
          Southern platyfish  ===
      Yellowbelly pufferfish  ===
B D                      Fugu  ===
B D                    Turkey  ===
B D                   Chicken  ===
  D              Mallard duck  ===
          Tibetan ground jay  ===
B D               Zebra finch  ===
B D           Tasmanian devil  ===
    Mexican tetra (cavefish)  ===
B D                 Zebrafish  ===
B D                    Medaka  ===
         Pundamilia nyererei  ===
                 Zebra mbuna  ===
       Burton's mouthbreeder  ===
         Princess of Burundi  ===
B D              Nile tilapia  ===
B D             X. tropicalis  ===
  D            Painted turtle  ===
  D           Green seaturtle  ===
B D        American alligator  ===
  D             Scarlet macaw  ===
B D                Budgerigar  ===
B D                   Opossum  ===
      Lesser Egyptian jerboa  ===
  D               Rock pigeon  ===
  D       Collared flycatcher  NNN
B D       Medium ground finch  ===
B D                    Lizard  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
  D                    Parrot  ===
          Chinese tree shrew  ===
B D                  Platypus  ===
B D                   Wallaby  ===
  D  Chinese softshell turtle  ===

Inserts between block 22 and 23 in window
B D           Naked mole-rat 280bp
                  Chinchilla 245bp

Alignment block 23 of 941 in window, 56745583 - 56745583, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  g
B D                  Bushbaby  g
B D                  Squirrel  g
                 Prairie vole  g
B D           Chinese hamster  g
               Golden hamster  g
B D                     Mouse  g
B D                       Rat  g
B D            Naked mole-rat  g
B D                Guinea pig  g
                   Chinchilla  g
B D                    Rabbit  g
B D                       Pig  g
B D                    Alpaca  g
               Bactrian camel  g
B D                   Dolphin  g
                 Killer whale  g
             Tibetan antelope  a
B D                       Cow  a
B D                     Sheep  a
                Domestic goat  a
B D                     Horse  a
B D          White rhinoceros  g
B D                       Cat  g
B D                       Dog  g
B D                   Ferret   g
B D                     Panda  g
               Pacific walrus  g
                 Weddell seal  g
             Black flying-fox  g
B D                   Megabat  g
                Big brown bat  g
         David's myotis (bat)  g
  D          Little brown bat  g
B D                     Shrew  g
              Star-nosed mole  g
B D                  Elephant  g
          Cape elephant shrew  g
B D                   Manatee  g
B D                    Tenrec  g
                     Aardvark  g
B D                 Armadillo  g
B D                  Hedgehog  =
B D                      Pika  =
B D                   Lamprey  =
B D                Coelacanth  =
B D       Crab-eating macaque  N
            Brush-tailed rat  =
B D              Atlantic cod  =
                 Spotted gar  =
B D               Stickleback  =
          Southern platyfish  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  =
B D           Tasmanian devil  =
    Mexican tetra (cavefish)  =
B D                 Zebrafish  =
B D                    Medaka  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D              Nile tilapia  =
B D             X. tropicalis  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  =
  D             Scarlet macaw  =
B D                Budgerigar  =
B D                   Opossum  =
      Lesser Egyptian jerboa  =
  D               Rock pigeon  =
  D       Collared flycatcher  N
B D       Medium ground finch  =
B D                    Lizard  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
            Cape golden mole  -
          Chinese tree shrew  =
B D                  Platypus  =
B D                   Wallaby  =
  D  Chinese softshell turtle  =

Alignment block 24 of 941 in window, 56745584 - 56745584, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  c
B D                  Bushbaby  c
           Chinese tree shrew  c
B D                  Squirrel  c
                 Prairie vole  t
B D           Chinese hamster  c
               Golden hamster  t
B D                     Mouse  c
B D                       Rat  c
B D            Naked mole-rat  c
B D                Guinea pig  c
                   Chinchilla  c
B D                    Rabbit  c
B D                       Pig  c
B D                    Alpaca  c
               Bactrian camel  c
B D                   Dolphin  c
                 Killer whale  c
             Tibetan antelope  c
B D                       Cow  c
B D                     Sheep  c
                Domestic goat  c
B D                     Horse  c
B D          White rhinoceros  c
B D                       Cat  c
B D                       Dog  c
B D                   Ferret   c
B D                     Panda  c
               Pacific walrus  c
                 Weddell seal  c
             Black flying-fox  c
B D                   Megabat  c
                Big brown bat  c
         David's myotis (bat)  c
  D          Little brown bat  c
B D                     Shrew  g
              Star-nosed mole  g
B D                  Elephant  c
          Cape elephant shrew  c
B D                   Manatee  c
B D                    Tenrec  c
                     Aardvark  c
B D                 Armadillo  c
B D                  Hedgehog  =
B D                      Pika  =
B D                   Lamprey  =
B D                Coelacanth  =
B D       Crab-eating macaque  N
            Brush-tailed rat  =
B D              Atlantic cod  =
                 Spotted gar  =
B D               Stickleback  =
          Southern platyfish  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  =
B D           Tasmanian devil  =
    Mexican tetra (cavefish)  =
B D                 Zebrafish  =
B D                    Medaka  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D              Nile tilapia  =
B D             X. tropicalis  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  =
  D             Scarlet macaw  =
B D                Budgerigar  =
B D                   Opossum  =
      Lesser Egyptian jerboa  =
  D               Rock pigeon  =
  D       Collared flycatcher  N
B D       Medium ground finch  =
B D                    Lizard  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
            Cape golden mole  -
B D                  Platypus  =
B D                   Wallaby  =
  D  Chinese softshell turtle  =

Alignment block 25 of 941 in window, 56745585 - 56745604, 20 bps 
B D                     Human  tactatgactttaaa-tgatc
B D                     Chimp  tactatgactttaaa-tgatc
B D                   Gorilla  tactatgactttaaa-tgatc
B D                 Orangutan  tactatgactttaaa-tgatc
B D                    Gibbon  tactatgactttaaa-tgatc
B D                    Rhesus  tactatgactttaaa-tgatc
B D                    Baboon  tactatgactttaaa-tgatc
B D              Green monkey  tactatgactttaaa-tgatc
B D                  Marmoset  tactatggct-----------
B D           Squirrel monkey  tactatgactttaaa-tgatc
B D                  Bushbaby  tattgtaactttaaa-ttatc
           Chinese tree shrew  tattatgcctttaaa-tgg--
B D                  Squirrel  tgttatgattttaaa-tgatc
                 Prairie vole  tactatgattttaaa-tgacc
B D           Chinese hamster  tactatgactttaaa-cgatc
               Golden hamster  taccataactttaaa-ccatc
B D                     Mouse  tattatggctttaaa-tgatc
B D                       Rat  tattatggctttaca-tgatc
B D            Naked mole-rat  tactaggactttaaa------
B D                Guinea pig  tattatgattttaaa-tgatt
                   Chinchilla  tactatgactttaaa-tggtc
B D                    Rabbit  tatt--gacttaaat-tgatc
B D                       Pig  tactaagattttaac-tgacc
B D                    Alpaca  tactatgattttaat-tgacc
               Bactrian camel  tactatgattttaat-tgacc
B D                   Dolphin  tactatgattttaat-tgatc
                 Killer whale  tactatgattttaat-tgatc
             Tibetan antelope  tactatgattttaac-tgatc
B D                       Cow  tactatgattttaac-tgatc
B D                     Sheep  tactatgattttaac-tgatc
                Domestic goat  tactattattttaac-tgatc
B D                     Horse  tactatgattttaac-tgatc
B D          White rhinoceros  tactatgattttaat-tgatc
B D                       Cat  tactatga--ttatt-tgatc
B D                       Dog  tactatga--ttatt-tgatc
B D                   Ferret   tactgtga--ttatt-tgatc
B D                     Panda  tactatga--ttatt-tgatc
               Pacific walrus  tactatga--ttatt-tgatc
                 Weddell seal  tactatga--ttatt-tgatc
             Black flying-fox  tactacgattttaat-tgatc
B D                   Megabat  tactacgattttaat-tgatc
                Big brown bat  -actatgattttaat-tgatc
         David's myotis (bat)  -actatgattttgat-tgatc
  D          Little brown bat  -ac--tgattttgat-tgatg
B D                  Hedgehog  tactattatatctat-agatc
B D                     Shrew  cattataattgtatt-tgact
              Star-nosed mole  tactatgattttaat-tgttc
B D                  Elephant  tactacaatattaat-tgatc
          Cape elephant shrew  tactacaatattaatctgtta
B D                   Manatee  tactaccatattaat-tgatt
             Cape golden mole  -gctacaatattaat-tgatc
B D                    Tenrec  tgctacaagattagt-tgatc
                     Aardvark  tattgcagtattaat-tgatc
B D                 Armadillo  tactatgattttaat-tgatt
B D                      Pika  =====================
B D                   Lamprey  =====================
B D                Coelacanth  =====================
B D       Crab-eating macaque  NNNNNNNNNNNNNNNNNNNNN
            Brush-tailed rat  =====================
B D              Atlantic cod  =====================
                 Spotted gar  =====================
B D               Stickleback  =====================
          Southern platyfish  =====================
      Yellowbelly pufferfish  =====================
B D                      Fugu  =====================
B D                    Turkey  =====================
B D                   Chicken  =====================
  D              Mallard duck  =====================
          Tibetan ground jay  =====================
B D               Zebra finch  =====================
B D           Tasmanian devil  =====================
    Mexican tetra (cavefish)  =====================
B D                 Zebrafish  =====================
B D                    Medaka  =====================
         Pundamilia nyererei  =====================
                 Zebra mbuna  =====================
       Burton's mouthbreeder  =====================
         Princess of Burundi  =====================
B D              Nile tilapia  =====================
B D             X. tropicalis  =====================
  D            Painted turtle  =====================
  D           Green seaturtle  =====================
B D        American alligator  =====================
  D             Scarlet macaw  =====================
B D                Budgerigar  =====================
B D                   Opossum  =====================
      Lesser Egyptian jerboa  =====================
  D               Rock pigeon  =====================
  D       Collared flycatcher  NNNNNNNNNNNNNNNNNNNNN
B D       Medium ground finch  =====================
B D                    Lizard  =====================
  D          Peregrine falcon  =====================
  D              Saker falcon  =====================
  D                    Parrot  =====================
B D                  Platypus  =====================
B D                   Wallaby  =====================
  D  Chinese softshell turtle  =====================

Inserts between block 25 and 26 in window
B D          Chinese hamster 9bp

Alignment block 26 of 941 in window, 56745605 - 56745608, 4 bps 
B D                     Human  tatt
B D                     Chimp  tatt
B D                   Gorilla  tatt
B D                 Orangutan  tatt
B D                    Gibbon  tatt
B D                    Rhesus  tgtt
B D                    Baboon  tgtt
B D              Green monkey  tgtt
B D           Squirrel monkey  tatc
B D                  Bushbaby  tatt
B D                  Squirrel  -att
                 Prairie vole  -act
               Golden hamster  -att
B D                     Mouse  -att
B D                       Rat  -att
B D            Naked mole-rat  ---t
B D                Guinea pig  -act
                   Chinchilla  -att
B D                    Rabbit  tttt
B D                       Pig  taat
B D                    Alpaca  tact
               Bactrian camel  tact
B D                   Dolphin  tact
                 Killer whale  tact
             Tibetan antelope  tact
B D                       Cow  tgct
B D                     Sheep  tact
                Domestic goat  tact
B D                     Horse  tact
B D          White rhinoceros  tact
B D                       Cat  tgct
B D                       Dog  tgct
B D                   Ferret   tgct
B D                     Panda  tgct
               Pacific walrus  tgct
                 Weddell seal  tgc-
             Black flying-fox  aact
B D                   Megabat  aact
                Big brown bat  tgct
         David's myotis (bat)  tact
  D          Little brown bat  tact
B D                  Hedgehog  tact
B D                     Shrew  tgct
              Star-nosed mole  tacc
B D                  Elephant  tatt
          Cape elephant shrew  catt
B D                   Manatee  tatt
             Cape golden mole  tgtt
B D                    Tenrec  tatt
B D                 Armadillo  tatt
B D                      Pika  ====
B D                   Lamprey  ====
B D                Coelacanth  ====
B D       Crab-eating macaque  NNNN
            Brush-tailed rat  ====
B D              Atlantic cod  ====
                 Spotted gar  ====
B D               Stickleback  ====
          Southern platyfish  ====
      Yellowbelly pufferfish  ====
B D                      Fugu  ====
B D                    Turkey  ====
B D                   Chicken  ====
  D              Mallard duck  ====
          Tibetan ground jay  ====
B D               Zebra finch  ====
B D           Tasmanian devil  ====
    Mexican tetra (cavefish)  ====
B D                 Zebrafish  ====
B D                    Medaka  ====
         Pundamilia nyererei  ====
                 Zebra mbuna  ====
       Burton's mouthbreeder  ====
         Princess of Burundi  ====
B D              Nile tilapia  ====
B D             X. tropicalis  ====
  D            Painted turtle  ====
  D           Green seaturtle  ====
B D        American alligator  ====
  D             Scarlet macaw  ====
B D                Budgerigar  ====
B D                   Opossum  ====
      Lesser Egyptian jerboa  ====
  D               Rock pigeon  ====
  D       Collared flycatcher  NNNN
B D       Medium ground finch  ====
B D                    Lizard  ====
  D          Peregrine falcon  ====
  D              Saker falcon  ====
  D                    Parrot  ====
          Chinese tree shrew  ----
B D                  Platypus  ====
B D                   Wallaby  ====
B D           Chinese hamster  ====
                    Aardvark  ----
  D  Chinese softshell turtle  ====
B D                  Marmoset  ----

Inserts between block 26 and 27 in window
B D                  Manatee 167bp

Alignment block 27 of 941 in window, 56745609 - 56745610, 2 bps 
B D                     Human  gg
B D                     Chimp  gg
B D                   Gorilla  gg
B D                 Orangutan  gg
B D                    Gibbon  gg
B D                    Rhesus  gg
B D                    Baboon  gg
B D              Green monkey  gg
B D                  Marmoset  gg
B D           Squirrel monkey  gg
B D                  Bushbaby  gg
B D                  Squirrel  ag
                 Prairie vole  gt
               Golden hamster  gc
B D                     Mouse  gc
B D                       Rat  gc
B D            Naked mole-rat  gg
B D                Guinea pig  gg
                   Chinchilla  gg
B D                    Rabbit  gg
B D                       Pig  gg
B D                    Alpaca  ga
               Bactrian camel  ga
B D                   Dolphin  gg
                 Killer whale  gg
             Tibetan antelope  gg
B D                       Cow  gg
B D                     Sheep  ga
                Domestic goat  gg
B D                     Horse  gg
B D          White rhinoceros  gg
B D                       Cat  gg
B D                       Dog  gg
B D                   Ferret   ag
B D                     Panda  gg
               Pacific walrus  gg
             Black flying-fox  ag
B D                   Megabat  ag
                Big brown bat  ag
         David's myotis (bat)  ag
  D          Little brown bat  ag
B D                  Hedgehog  ga
B D                     Shrew  gg
              Star-nosed mole  ag
B D                  Elephant  aa
B D                   Manatee  ag
             Cape golden mole  ag
B D                    Tenrec  ag
B D                 Armadillo  ga
B D                      Pika  ==
B D                   Lamprey  ==
B D                Coelacanth  ==
B D       Crab-eating macaque  NN
            Brush-tailed rat  ==
B D              Atlantic cod  ==
                 Spotted gar  ==
B D               Stickleback  ==
          Southern platyfish  ==
      Yellowbelly pufferfish  ==
B D                      Fugu  ==
B D                    Turkey  ==
B D                   Chicken  ==
  D              Mallard duck  ==
          Tibetan ground jay  ==
B D               Zebra finch  ==
B D           Tasmanian devil  ==
    Mexican tetra (cavefish)  ==
B D                 Zebrafish  ==
B D                    Medaka  ==
         Pundamilia nyererei  ==
                 Zebra mbuna  ==
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
B D              Nile tilapia  ==
B D             X. tropicalis  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D        American alligator  ==
  D             Scarlet macaw  ==
B D                Budgerigar  ==
B D                   Opossum  ==
      Lesser Egyptian jerboa  ==
  D               Rock pigeon  ==
  D       Collared flycatcher  NN
B D       Medium ground finch  ==
B D                    Lizard  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D                    Parrot  ==
          Chinese tree shrew  --
         Cape elephant shrew  --
B D                  Platypus  ==
B D                   Wallaby  ==
B D           Chinese hamster  ==
                    Aardvark  --
  D  Chinese softshell turtle  ==
                Weddell seal  --

Inserts between block 27 and 28 in window
B D                 Marmoset 335bp

Alignment block 28 of 941 in window, 56745611 - 56745612, 2 bps 
B D                     Human  ta
B D                     Chimp  ta
B D                   Gorilla  ta
B D                 Orangutan  ta
B D                    Gibbon  ta
B D                    Rhesus  ta
B D                    Baboon  ta
B D              Green monkey  ta
B D                  Marmoset  ta
B D           Squirrel monkey  ta
B D                  Bushbaby  ta
           Chinese tree shrew  ta
B D                  Squirrel  ta
                 Prairie vole  ta
               Golden hamster  ta
B D                     Mouse  tt
B D                       Rat  ta
B D            Naked mole-rat  ta
B D                Guinea pig  ta
                   Chinchilla  ta
B D                    Rabbit  ta
B D                       Pig  ta
B D                    Alpaca  ta
               Bactrian camel  ta
B D                   Dolphin  ta
                 Killer whale  ta
             Tibetan antelope  ta
B D                       Cow  ta
B D                     Sheep  ta
                Domestic goat  ta
B D                     Horse  ta
B D          White rhinoceros  ta
B D                       Cat  ta
B D                       Dog  ta
B D                   Ferret   ta
B D                     Panda  ta
               Pacific walrus  ta
                 Weddell seal  ta
             Black flying-fox  aa
B D                   Megabat  aa
                Big brown bat  ta
         David's myotis (bat)  ca
  D          Little brown bat  ta
B D                  Hedgehog  ta
B D                     Shrew  ta
              Star-nosed mole  ta
B D                  Elephant  ta
B D                   Manatee  ta
             Cape golden mole  ta
B D                    Tenrec  ta
B D                 Armadillo  ta
B D                      Pika  ==
B D                   Lamprey  ==
B D                Coelacanth  ==
B D       Crab-eating macaque  NN
            Brush-tailed rat  ==
B D              Atlantic cod  ==
                 Spotted gar  ==
B D               Stickleback  ==
          Southern platyfish  ==
      Yellowbelly pufferfish  ==
B D                      Fugu  ==
B D                    Turkey  ==
B D                   Chicken  ==
  D              Mallard duck  ==
          Tibetan ground jay  ==
B D               Zebra finch  ==
B D           Tasmanian devil  ==
    Mexican tetra (cavefish)  ==
B D                 Zebrafish  ==
B D                    Medaka  ==
         Pundamilia nyererei  ==
                 Zebra mbuna  ==
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
B D              Nile tilapia  ==
B D             X. tropicalis  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D        American alligator  ==
  D             Scarlet macaw  ==
B D                Budgerigar  ==
B D                   Opossum  ==
      Lesser Egyptian jerboa  ==
  D               Rock pigeon  ==
  D       Collared flycatcher  NN
B D       Medium ground finch  ==
B D                    Lizard  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D                    Parrot  ==
         Cape elephant shrew  --
B D                  Platypus  ==
B D                   Wallaby  ==
B D           Chinese hamster  ==
                    Aardvark  --
  D  Chinese softshell turtle  ==

Inserts between block 28 and 29 in window
              Golden hamster 6bp

Alignment block 29 of 941 in window, 56745613 - 56745627, 15 bps 
B D                     Human  agatcatttactctg
B D                     Chimp  agatcatttactctg
B D                   Gorilla  agatcatttactctg
B D                 Orangutan  agatcatttactctg
B D                    Gibbon  agatcatttactctg
B D                    Rhesus  agatcatctttaatg
B D                    Baboon  agatcatctttaatg
B D              Green monkey  agatcatctttaatg
B D                  Marmoset  acttcatttactcta
B D           Squirrel monkey  acttcgtttactcta
B D                  Bushbaby  gaatcatctactctt
           Chinese tree shrew  aggtcatctaccctg
B D                  Squirrel  acatcatctactctg
                 Prairie vole  agatcacttagtcta
B D                     Mouse  agt----ttacttta
B D                       Rat  agttcacttactcta
B D            Naked mole-rat  agatcgtctactctg
B D                Guinea pig  agattatctactctg
                   Chinchilla  agatcatctactctg
B D                    Rabbit  aaataatccactctg
B D                       Pig  aaatcatctactctg
B D                    Alpaca  aaa-catctactctg
               Bactrian camel  aaa-catctactctg
B D                   Dolphin  aaatcatctactctg
                 Killer whale  aaatcatcttctctg
             Tibetan antelope  aaatcatttactctg
B D                       Cow  aaatcatttactctg
B D                     Sheep  aaatcatttactctg
                Domestic goat  aaatcatttactctg
B D                     Horse  acatcatctaccctg
B D          White rhinoceros  agatcatctactctg
B D                       Cat  agatcatctactctg
B D                       Dog  agatcatctactctg
B D                   Ferret   aggtcatttactctg
B D                     Panda  agatcatctactctg
               Pacific walrus  agatcatctactctg
                 Weddell seal  agatcatctactctg
             Black flying-fox  agatcatctactctg
B D                   Megabat  agatcatctactctg
                Big brown bat  agatcacctactctg
         David's myotis (bat)  agatcacctcctctg
  D          Little brown bat  agatcacctactctg
B D                  Hedgehog  aaatcacctagtttg
B D                     Shrew  ggatcatttactctg
              Star-nosed mole  agatcctt--ctctc
B D                  Elephant  agattacctactctg
          Cape elephant shrew  ------tttactctg
B D                   Manatee  agattatctactctg
             Cape golden mole  agactatctactctg
B D                    Tenrec  aaaggctctattctg
                     Aardvark  ---ttgtctactctg
B D                 Armadillo  agatcatc-actctg
B D                      Pika  ===============
B D                   Lamprey  ===============
B D                Coelacanth  ===============
              Golden hamster  ===============
B D       Crab-eating macaque  NNNNNNNNNNNNNNN
            Brush-tailed rat  ===============
B D              Atlantic cod  ===============
                 Spotted gar  ===============
B D               Stickleback  ===============
          Southern platyfish  ===============
      Yellowbelly pufferfish  ===============
B D                      Fugu  ===============
B D                    Turkey  ===============
B D                   Chicken  ===============
  D              Mallard duck  ===============
          Tibetan ground jay  ===============
B D               Zebra finch  ===============
B D           Tasmanian devil  ===============
    Mexican tetra (cavefish)  ===============
B D                 Zebrafish  ===============
B D                    Medaka  ===============
         Pundamilia nyererei  ===============
                 Zebra mbuna  ===============
       Burton's mouthbreeder  ===============
         Princess of Burundi  ===============
B D              Nile tilapia  ===============
B D             X. tropicalis  ===============
  D            Painted turtle  ===============
  D           Green seaturtle  ===============
B D        American alligator  ===============
  D             Scarlet macaw  ===============
B D                Budgerigar  ===============
B D                   Opossum  ===============
      Lesser Egyptian jerboa  ===============
  D               Rock pigeon  ===============
  D       Collared flycatcher  NNNNNNNNNNNNNNN
B D       Medium ground finch  ===============
B D                    Lizard  ===============
  D          Peregrine falcon  ===============
  D              Saker falcon  ===============
  D                    Parrot  ===============
B D                  Platypus  ===============
B D                   Wallaby  ===============
B D           Chinese hamster  ===============
  D  Chinese softshell turtle  ===============

Inserts between block 29 and 30 in window
B D                   Tenrec 15bp

Alignment block 30 of 941 in window, 56745628 - 56745633, 6 bps 
B D                     Human  caatgt
B D                     Chimp  caatgt
B D                   Gorilla  caatgt
B D                 Orangutan  caatgt
B D                    Gibbon  caatgt
B D                    Rhesus  caatgt
B D                    Baboon  caatgt
B D              Green monkey  caatgt
B D                  Marmoset  caatgt
B D           Squirrel monkey  caatgt
B D                  Bushbaby  aaatat
           Chinese tree shrew  gaatgt
B D                  Squirrel  ggatga
                 Prairie vole  aaacat
B D                     Mouse  ggatat
B D                       Rat  ggatat
B D            Naked mole-rat  gaatgt
B D                Guinea pig  gaatgt
                   Chinchilla  gaatgt
B D                    Rabbit  gaatgt
B D                       Pig  aaatat
B D                    Alpaca  aaatgt
               Bactrian camel  aaatgt
B D                   Dolphin  aaatac
                 Killer whale  aaatac
             Tibetan antelope  aaatat
B D                       Cow  aaatat
B D                     Sheep  aaatat
                Domestic goat  aaatat
B D                     Horse  ggatgt
B D          White rhinoceros  gaatgt
B D                       Cat  gaatgt
B D                       Dog  gaatat
B D                   Ferret   gaatat
B D                     Panda  gaatgt
               Pacific walrus  gaatgt
                 Weddell seal  gaatgt
             Black flying-fox  gaatgc
B D                   Megabat  gaatgc
                Big brown bat  gaaagt
         David's myotis (bat)  gaaagt
  D          Little brown bat  gaaagt
B D                  Hedgehog  gaatgt
B D                     Shrew  gaaagt
              Star-nosed mole  aaatat
B D                  Elephant  aaatgt
          Cape elephant shrew  gaatgt
B D                   Manatee  gaatgt
             Cape golden mole  aaatat
                     Aardvark  gaatgt
B D                 Armadillo  gaatgt
B D                      Pika  ======
B D                   Lamprey  ======
B D                Coelacanth  ======
              Golden hamster  ======
B D       Crab-eating macaque  NNNNNN
            Brush-tailed rat  ======
B D              Atlantic cod  ======
                 Spotted gar  ======
B D               Stickleback  ======
          Southern platyfish  ======
      Yellowbelly pufferfish  ======
B D                      Fugu  ======
B D                    Turkey  ======
B D                   Chicken  ======
  D              Mallard duck  ======
          Tibetan ground jay  ======
B D               Zebra finch  ======
B D           Tasmanian devil  ======
    Mexican tetra (cavefish)  ======
B D                 Zebrafish  ======
B D                    Medaka  ======
         Pundamilia nyererei  ======
                 Zebra mbuna  ======
       Burton's mouthbreeder  ======
         Princess of Burundi  ======
B D              Nile tilapia  ======
B D             X. tropicalis  ======
  D            Painted turtle  ======
  D           Green seaturtle  ======
B D        American alligator  ======
  D             Scarlet macaw  ======
B D                Budgerigar  ======
B D                   Opossum  ======
      Lesser Egyptian jerboa  ======
  D               Rock pigeon  ======
  D       Collared flycatcher  NNNNNN
B D       Medium ground finch  ======
B D                    Lizard  ======
  D          Peregrine falcon  ======
  D              Saker falcon  ======
  D                    Parrot  ======
B D                  Platypus  ======
B D                   Wallaby  ======
B D           Chinese hamster  ======
B D                    Tenrec  ======
  D  Chinese softshell turtle  ======

Inserts between block 30 and 31 in window
         Cape elephant shrew 162bp

Alignment block 31 of 941 in window, 56745634 - 56745637, 4 bps 
B D                     Human  gaat
B D                     Chimp  gaat
B D                   Gorilla  gaat
B D                 Orangutan  gaat
B D                    Gibbon  gaat
B D                    Rhesus  gaat
B D                    Baboon  gaat
B D              Green monkey  gaat
B D                  Marmoset  gaat
B D           Squirrel monkey  gaat
B D                  Bushbaby  aaat
           Chinese tree shrew  gaat
B D                  Squirrel  gaag
                 Prairie vole  gaat
B D                     Mouse  gaat
B D                       Rat  gaat
B D            Naked mole-rat  gaat
B D                Guinea pig  gaat
                   Chinchilla  gagt
B D                    Rabbit  gaat
B D                       Pig  ggat
B D                    Alpaca  ggat
               Bactrian camel  ggat
B D                   Dolphin  aaat
                 Killer whale  aaat
             Tibetan antelope  gaat
B D                       Cow  gaat
B D                     Sheep  gaat
                Domestic goat  gaat
B D                     Horse  ggat
B D          White rhinoceros  ggat
B D                       Cat  ggat
B D                       Dog  gcat
B D                   Ferret   ggat
B D                     Panda  ggat
               Pacific walrus  ggat
                 Weddell seal  ggat
             Black flying-fox  ggat
B D                   Megabat  ggat
                Big brown bat  ggat
         David's myotis (bat)  ggat
  D          Little brown bat  ggat
B D                  Hedgehog  gagt
B D                     Shrew  ggac
              Star-nosed mole  ggat
B D                  Elephant  ggat
B D                   Manatee  agat
             Cape golden mole  tgat
                     Aardvark  ggat
B D                 Armadillo  ggat
B D                      Pika  ====
B D                   Lamprey  ====
B D                Coelacanth  ====
              Golden hamster  ====
B D       Crab-eating macaque  NNNN
            Brush-tailed rat  ====
B D              Atlantic cod  ====
                 Spotted gar  ====
B D               Stickleback  ====
          Southern platyfish  ====
      Yellowbelly pufferfish  ====
B D                      Fugu  ====
B D                    Turkey  ====
B D                   Chicken  ====
  D              Mallard duck  ====
          Tibetan ground jay  ====
B D               Zebra finch  ====
B D           Tasmanian devil  ====
    Mexican tetra (cavefish)  ====
B D                 Zebrafish  ====
B D                    Medaka  ====
         Pundamilia nyererei  ====
                 Zebra mbuna  ====
       Burton's mouthbreeder  ====
         Princess of Burundi  ====
B D              Nile tilapia  ====
B D             X. tropicalis  ====
  D            Painted turtle  ====
  D           Green seaturtle  ====
B D        American alligator  ====
  D             Scarlet macaw  ====
B D                Budgerigar  ====
B D                   Opossum  ====
      Lesser Egyptian jerboa  ====
  D               Rock pigeon  ====
  D       Collared flycatcher  NNNN
B D       Medium ground finch  ====
B D                    Lizard  ====
  D          Peregrine falcon  ====
  D              Saker falcon  ====
  D                    Parrot  ====
         Cape elephant shrew  ====
B D                  Platypus  ====
B D                   Wallaby  ====
B D           Chinese hamster  ====
B D                    Tenrec  ====
  D  Chinese softshell turtle  ====

Inserts between block 31 and 32 in window
B D                      Dog 2bp

Alignment block 32 of 941 in window, 56745638 - 56745642, 5 bps 
B D                     Human  gcca--t
B D                     Chimp  gcca--t
B D                   Gorilla  gcca--t
B D                 Orangutan  gcca--t
B D                    Gibbon  gcca--t
B D                    Rhesus  gcca--t
B D                    Baboon  gcca--t
B D              Green monkey  gcca--t
B D                  Marmoset  gcca--t
B D           Squirrel monkey  gcca--t
B D                  Bushbaby  gcta--t
           Chinese tree shrew  acta--t
B D                  Squirrel  tcta--t
                 Prairie vole  gctc--t
B D                     Mouse  gcta--t
B D                       Rat  gcta--t
B D            Naked mole-rat  gcta--t
B D                Guinea pig  ggta--t
                   Chinchilla  ggta---
B D                    Rabbit  gctg--t
B D                       Pig  gcta-t-
B D                    Alpaca  gctat--
               Bactrian camel  gctat--
B D                   Dolphin  tctt---
                 Killer whale  tctt---
             Tibetan antelope  gctt---
B D                       Cow  actt---
B D                     Sheep  gctt---
                Domestic goat  gctt---
B D                     Horse  gcta--t
B D          White rhinoceros  gcta--t
B D                       Cat  gctc--t
B D                   Ferret   gcta--t
B D                     Panda  gcta--t
               Pacific walrus  gcta--t
                 Weddell seal  gcta--t
             Black flying-fox  gcta--t
B D                   Megabat  gcta--t
                Big brown bat  gcta--t
         David's myotis (bat)  gcta--t
  D          Little brown bat  gcta--t
B D                  Hedgehog  -----gt
B D                     Shrew  -----ac
              Star-nosed mole  -----gt
B D                  Elephant  gcta--t
B D                   Manatee  gtta--t
             Cape golden mole  gctt--t
                     Aardvark  gcta--t
B D                 Armadillo  tgta--c
B D                      Pika  =======
B D                   Lamprey  =======
B D                Coelacanth  =======
              Golden hamster  =======
B D       Crab-eating macaque  NNNNNNN
            Brush-tailed rat  =======
B D              Atlantic cod  =======
                 Spotted gar  =======
B D               Stickleback  =======
          Southern platyfish  =======
      Yellowbelly pufferfish  =======
B D                      Fugu  =======
B D                    Turkey  =======
B D                   Chicken  =======
  D              Mallard duck  =======
          Tibetan ground jay  =======
B D               Zebra finch  =======
B D           Tasmanian devil  =======
    Mexican tetra (cavefish)  =======
B D                 Zebrafish  =======
B D                    Medaka  =======
         Pundamilia nyererei  =======
                 Zebra mbuna  =======
       Burton's mouthbreeder  =======
         Princess of Burundi  =======
B D              Nile tilapia  =======
B D             X. tropicalis  =======
  D            Painted turtle  =======
  D           Green seaturtle  =======
B D        American alligator  =======
  D             Scarlet macaw  =======
B D                Budgerigar  =======
B D                   Opossum  =======
      Lesser Egyptian jerboa  =======
  D               Rock pigeon  =======
  D       Collared flycatcher  NNNNNNN
B D       Medium ground finch  =======
B D                    Lizard  =======
  D          Peregrine falcon  =======
  D              Saker falcon  =======
  D                    Parrot  =======
         Cape elephant shrew  =======
B D                  Platypus  =======
B D                   Wallaby  =======
B D           Chinese hamster  =======
B D                    Tenrec  =======
  D  Chinese softshell turtle  =======
B D                       Dog  =======

Inserts between block 32 and 33 in window
B D                 Squirrel 1bp
B D               Guinea pig 378bp
B D                 Hedgehog 3bp
             Star-nosed mole 5bp

Alignment block 33 of 941 in window, 56745643 - 56745645, 3 bps 
B D                     Human  taa
B D                     Chimp  taa
B D                   Gorilla  taa
B D                 Orangutan  taa
B D                    Gibbon  taa
B D                    Rhesus  taa
B D                    Baboon  taa
B D              Green monkey  taa
B D                  Marmoset  taa
B D           Squirrel monkey  taa
           Chinese tree shrew  caa
                 Prairie vole  aaa
B D                     Mouse  taa
B D                       Rat  aaa
B D            Naked mole-rat  -aa
                   Chinchilla  taa
B D                       Pig  aaa
B D                       Cow  aaa
B D                       Cat  aaa
             Black flying-fox  aaa
B D                   Megabat  aaa
B D                  Hedgehog  caa
B D                     Shrew  taa
B D                  Elephant  aaa
B D                   Manatee  aaa
             Cape golden mole  gaa
B D                Guinea pig  ===
B D                      Pika  ===
B D                    Rabbit  ---
B D                   Lamprey  ===
B D                Coelacanth  ===
              Golden hamster  ===
B D       Crab-eating macaque  NNN
            Brush-tailed rat  ===
B D              Atlantic cod  ===
                 Spotted gar  ===
B D               Stickleback  ===
          Southern platyfish  ===
      Yellowbelly pufferfish  ===
B D                      Fugu  ===
B D                    Turkey  ===
B D                   Chicken  ===
  D              Mallard duck  ===
          Tibetan ground jay  ===
B D               Zebra finch  ===
B D           Tasmanian devil  ===
    Mexican tetra (cavefish)  ===